Información

Co-transformación de plásmidos del mismo grupo de incompatibilidad

Co-transformación de plásmidos del mismo grupo de incompatibilidad


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

¿Pueden dos plásmidos con el mismo origen de replicación (por ejemplo, pBR322 ori) y, por tanto, del mismo grupo de incompatibilidad, co-transformarse con éxito en E. coli? ¿Cuáles son los mecanismos que evitarían que los dos plásmidos coexistan juntos? ¿Importa cuál es la selección de resistencia dual? ¿Cómo se compararía la eficiencia de la cotransformación con la eficiencia de una unitransformación?


Resulta que no parece haber un mecanismo específico para evitar que coexistan múltiples plásmidos incompatibles. Velappan et al colocaron más de un plásmido incompatible con diferentes genes de selección en ellos y colocaron las bacterias en un solo antibiótico y verificaron periódicamente el segundo vector (mediante la prueba de resistencia al segundo antibiótico). Al parecer, el segundo vector tardó semanas en desaparecer: muchas generaciones.

Los plásmidos con mayor número de copias obtuvieron mejores resultados, con tiempos más largos para perder el segundo plásmido. Parecen concluir que es solo la tasa natural de pérdida de plásmidos lo que hará que las bacterias pierdan el segundo plásmido sin selección. Me imagino que con dos antibióticos en el cultivo tomaría algunos meses y potencialmente podría almacenar la bacteria a -80 ° C indefinidamente. Aún así, en la mayoría de los experimentos será un dolor de cabeza adicional donde los orígenes de replicación compatibles parecen tener una vida media más típica para retener los plásmidos.

También afirman que la frecuencia de las transformaciones dobles es más frecuente de lo que se suele apreciar, lo que parece implicar que obtendrá algunas colonias de una transformación típica de alta eficiencia de las preparaciones de plásmidos. Sin embargo, introdujeron los plásmidos múltiples por infección por fagémidos en lugar de transformación en este estudio.


Perfilado de plásmidos y agrupación de incompatibilidad de resistentes a múltiples fármacos Salmonella enterica Aislamientos de serovar Typhi en Nairobi, Kenia

Los plásmidos albergan genes de resistencia a los antibióticos que contribuyen a la aparición de patógenos resistentes a múltiples fármacos. Detectamos la presencia de plásmidos en multirresistentes. Salmonella enterica serovar TyphiS. Typhi) se aísla de nuestro estudio anterior y, en consecuencia, determinaron sus grupos de incompatibilidad y la posibilidad de transmisión de conjugación. Los plásmidos se extrajeron de 98 resistentes a múltiples fármacos S. Aislamientos de Typhi basados ​​en la técnica de lisis alcalina. La agrupación de incompatibilidad de plásmidos se estableció mediante tipificación de replicones por PCR utilizando 18 pares de cebadores para amplificar FIA, FIB, FIC, HI1, HI2, I1-Iγ, L / M, N, P, W, T, A / C, K, B / Replicones O, X, Y, F y FIIA. Los fenotipos de resistencia a los antibióticos se transfirieron conyugalmente de S. Typhi se aísla con plásmidos para Escherichia coli Cepa K12F desprovista de plásmidos.

Resultados

Aproximadamente el 79,6% de la MDR S. Los aislados de Typhi se relacionaron con la existencia de plásmidos. Detectamos el 93,6% de plásmidos pertenecientes al grupo de incompatibilidad (Inc) HI1. Los otros grupos de incompatibilidad identificados incluyeron IncFIC (16,7%), IncP (1,3%) e IncI1 (1,3%) que aparecieron junto con Inc HI1. MDR S. Typhi aislado portaba un plásmido homólogo del grupo de incompatibilidad HI1, la mayoría del cual transfirió los fenotipos de resistencia de ampicilina, tetraciclina y cloranfenicol a los transconjugantes.


Clínica tecnológica n. ° 4: ¿Puede una sola E. coli absorber 2 plásmidos?

La siguiente pregunta fue enviada por correo electrónico a Bitesize Bio por Beheroze Sattha y con mucho gusto acepté el desafío, e inmediatamente supe la respuesta. O eso pensé.

Después de profundizar mucho en Pubmed, Genes V (lo sé, necesito una nueva versión) y la Clonación Molecular, se me ocurrió una respuesta, pero no es lo que pensé originalmente y convierte algunos aspectos de mi comprensión de los plásmidos, la clonación y transformación en su cabeza. Entonces, aunque esta es mi mejor respuesta, me encantaría escuchar sus pensamientos al respecto.

Aquí está la pregunta de Beheroze & # 8217:

Me preguntaba si un solo E. coli puede tomar dos plásmidos. Estoy clonando una sección del genoma mitocondrial para buscar SNP. Después de la clonación y
secuenciación, me doy cuenta de que algunas secuencias muestran mezclas, por ejemplo, Y o R. ¿Significa esto que ese particular E. coli había tomado dos plásmidos, uno con una C y el
otro con (SNP) T, que cuando se secuencia se muestra como Y.

Mi reacción inicial fue que cada E. coli La célula solo puede ser transformada por una molécula de plásmido, que luego se propicia para producir una población clonal de bacterias que contiene solo una única especie de plásmido. Esa es la sabiduría común como yo la entiendo. ¿Pero es esto cierto? Y si es así, ¿cómo sucede?

Nuevamente, mi razonamiento inicial fue que es extremadamente raro que una sola E. coli sea transformada por dos moléculas de plásmido en una sola transformación. ¿Pero es esto cierto? Bueno, no, no lo es.

¡La doble transformación no es muy rara en absoluto!

En su preparación celular competente, solo una fracción de las células es realmente competente para absorber bacterias y una subpoblación de ellas puede absorber fácilmente dos o más plásmidos en una sola transformación.

Esto se demostró para la transformación de CaCl2 de E. coli por Weston et al en 1979 [1] y más recientemente para la electroporación [2]. Weston et al construyeron curvas de respuesta a la dosis (concentración de ADN plasmídico frente al número de transformantes obtenidos), que mostraron que solo el 0,26% de la población celular era transformable, y que solo el 10-20% de esas células competentes (es decir, aproximadamente el 0,052%) de la población podría absorber dos o más moléculas de plásmido. En el trabajo más reciente sobre electroporación, Goldsmith et al también demostraron que es posible que las células sean transformadas por dos moléculas de plásmido independientes en una transformación, y la frecuencia de las transformaciones dobles incluso aumenta exponencialmente con la concentración de plásmido.

Así que la doble transformación & # 8211 entrada de dos (o más) moléculas de plásmido en una sola E. coli en un solo procedimiento de transformación, no es tan infrecuente. De hecho, según las estadísticas de Weston et al & # 8217s, hasta el 20% de sus transformantes podrían ser transformantes dobles.

Pero, ¿qué pasa con los plásmidos que llevan el mismo replicón?

Pero en el experimento de Beheroze & # 8217s, los clones tienen diferentes inserciones en la misma columna vertebral del plásmido & # 8211 y todos tienen el mismo origen de replicación. La sabiduría convencional dice que si dos de esos plásmidos entran en una sola E. coli durante una transformación, la incompatibilidad de plásmidos dicta que no se propagarán ambos.

La incompatibilidad de plásmidos se define como el fracaso de dos plásmidos co-residentes en la misma célula para ser heredados de forma estable. Se dice que los plásmidos con orígenes de replicación similares y, por lo tanto, sistemas similares para regular la replicación y seggregación del plásmido, se encuentran en el mismo & # 8220 grupo de incompatibilidad & # 8221 y no pueden transmitirse de manera consistente a las células hijas. Esto se debe a que el número de copias de un plásmido está estrechamente regulado por el replicón y tener dos plásmidos con el mismo replicón interfiere con esta regulación porque comparten los factores reguladores necesarios para la replicación o partición durante la división celular. Efectivamente, los dos clones de plásmido compiten por los factores disponibles necesarios para la replicación y el reparto.

¿Cómo se produce la incompatibilidad de plásmidos en un transformante doble?

Una forma sencilla de pensar en esto es imaginar un plásmido con un número de copias de dos (ver figura 1A). La maquinaria reguladora del origen de replicación se establece para mantener el número de copias en dos, pero en un transformante doble que contiene dos clones de plásmido diferentes con el mismo origen de replicación, el número de copias del replicón ya es dos, por lo que no ocurrirá replicación. Los dos plásmidos luego se segregarán en diferentes células hijas después de la división celular, por lo que cada célula hija contendrá una población de plásmidos homogénea.

Todo esto está muy bien, pero si las células se colocan en placas antes de que tengan la oportunidad de dividirse, esto podría & # 8211 en mi opinión & # 8211 dar como resultado un clon que contiene dos clones de plásmido diferentes. Además, la mayoría de los plásmidos tienen un número de copias superior a 2, por lo que la situación es más complicada. Incluso con un número de copias de 4, las posibilidades de propiciar una población de plásmidos heterogénea aumentan, al parecer.

La sabiduría comúnmente entendida es que los dos clones de plásmido tendrán pequeñas diferencias que harán que uno tenga una tasa de replicación más rápida, o una mayor toxicidad, sobre el otro. Se dice que esto hace que los plásmidos se repliquen asimétricamente, contribuyendo a la eventual pérdida de uno de los clones.

Aparentemente, esto es cierto en muchos casos, pero un artículo de 2007 de Velappan et al [3] informa que en los transformantes dobles que contienen dos plásmidos con orígenes de replicación idénticos se pueden mantener juntos de manera estable en la misma E. coli durante muchos días, especialmente si un Se utiliza un origen de número de copia alto (como pUC).

Si considera que este es el contexto de una transformación, a mí me parece que es muy posible que Beheroze haya obtenido una colonia que contiene una población de plásmidos mixtos. Esto podría haber surgido de una sola E. coli que tomó dos clones diferentes durante la transformación y se propinó en las mismas células o en poblaciones separadas (o ambas) a medida que crecía la colonia.

¿Cómo se pueden evitar los transformantes dobles?

A partir de esto, parecería que en cualquier experimento en el que se esté transformando una población de plásmidos mixtos y se desee un clonado homogéneo, las transformaciones dobles deberían tenerse en cuenta, diagnosticarse y evitarse en la medida de lo posible.

1. Utilice concentraciones bajas de plásmido. Goldsmith et al demostraron que la doble transformación aumentaba exponencialmente con la concentración de plásmido, por lo que mantener la concentración de plásmido lo más baja posible, dadas las limitaciones de su experimento, debería ayudar.

2. Compruebe los clones mediante PCR de colonias o secuenciación. La PCR de colonias funcionará especialmente bien si la PCR proporciona bandas distintas para los clones positivos y negativos.
Si tienes un transformante doble, te darán dos bandas. Beheroze ha identificado clones dobles secuenciando las preparaciones de plásmido resultantes y notando que
la mezcla puede contener dos secuencias diferentes.

3. Elija más de un clon. Si tiene algunos transformantes dobles, deberían ser una minoría si elige un banco de clones positivos. Los positivos transformados individualmente deben identificarse fácilmente mediante PCR de colonias o secuenciación.

4. Si no tiene una gran cantidad de clones positivos, vuelva a aislar. Los clones positivos deben aislarse y utilizarse para inocular un cultivo fresco, colocarse en placa a baja densidad en una placa de agar y volver a analizar las colonias individuales. Si el clon original consistía en una población mixta de dos tipos de células que contienen plásmidos diferentes, ya sea debido a la doble transformación o al recubrimiento a una densidad demasiado alta, esto resolverá los dos (que es la otra posible explicación para el resultado de Beheroze & # 8217). Alternativamente, puede aislar los plásmidos del clon positivo y volver a transformarlos. Si su población de plásmidos se mezcló, obtendrá una placa de (en su mayoría) transformantes individuales que contienen uno u otro del plásmido originalmente cotransformado.

Debo decir que esto ha sido una verdadera revelación para mí, pero me gusta cuando puedo identificar una percepción que tengo cerca sin ninguna evidencia y hago el trabajo para iluminarla. Sin embargo, es posible que me falte algo aquí, por lo que si puede proporcionar más iluminación o tiene alguna pregunta, no dude en dejar un comentario.

1. Weston A y col. Transformación simultánea de Escherichia coli por pares de moléculas de ADN plasmídico compatibles e incompatibles. Genética Mol Gen (1979) 172 p113


¿Expresión de proteínas de bacterias que tienen dos plásmidos? - Incompatibilidad de plásmidos (27 / Jul / 2007)

Hola & # 33
Planeo expresar dos plásmidos en bacterias. Tendré dos vectores pET diferentes con origen F1. Tienen diferente resistencia a los antibióticos. ¿Alguien ha tenido & # 96bad & # 96 o & # 96buena & # 96 experiencia en la expresión de dos vectores pET? He leído que podría ser problemático expresar dos plásmidos en bhttp: //www.protocol-online.org/forums/style_images/1/folder_post_icons/icon2.gif
http://www.protocol-online.org/forums/styl. con2.gifacteria debido a la incompatibilidad de dos plásmidos. Pero no pude encontrar ninguna información sobre los criterios para ser considerados incompatibles.
Le agradecería sus respuestas.
Gracias

Realmente no lo entiendo. ¿Te refieres a transformar 2 plásmidos dentro de la bacteria? Hmm ... esta es la primera vez que escucho sobre eso. En mi opinión, no creo que sea una buena idea expresar 2 plásmidos a la vez. Expresar 1 plásmido en sí mismo es difícil.

5 plásmidos? Hmm, ¿qué tipo de bacterias pueden hacerlo? Tengo curiosidad. No soy un experto en eso. =)

Lo que quiere hacer es posible, ya que cada tipo de plásmido tiene su propio marcador de selección de antibióticos. Sin embargo, el sistema es inestable ya que dos plásmidos del mismo grupo de incompatibilidad interfieren con la herencia estable entre sí. Por tanto, la proporción de plásmido A a plásmido B variará de una célula a otra. algunas células tendrán más plásmido A y otras menos. Lo que a su vez da como resultado que la proporción de proteínas expresadas por cada plásmido difiera entre las células.

Hay alrededor de 30 grupos de incompatibilidad. Así que teoricamente podría haber

30 plásmidos conviviendo uno al lado del otro, siempre que cada plásmido provenga de un grupo de incompatibilidad diferente.

Aún así, 5 es mucho. Lo máximo que he leído es sobre 4. Las células de E. coli no eran demasiado felices. Demasiados antibióticos.

Puede mantener 2 plásmidos dentro de 1 E. coli, pero necesita:
- Diferentes factores de replicación (ori diferente)
- Diferentes marcadores de selección.

Como dijiste que tienes 2 vectores pET diferentes con origen F1, ¿supongo que la región ori para ambos vectores es la misma? Si es así, los dos plásmidos son incompatibles, no pueden mantenerse por mucho tiempo en la misma bacteria. Elija diferentes ori.


Marcado de ácidos nucleicos con radioisótopos

6.2 Estimación del número de copias de plásmido

Los plásmidos, elementos de ADN circular que se replican de forma autónoma y que se utilizan para la clonación de genes recombinantes, existen dentro de una célula en uno a varios cientos de copias. En una técnica para determinar cuántas copias de un plásmido están presentes dentro de una célula individual, se hace crecer un cultivo de la cepa portadora del plásmido en presencia de [3 H] -timina o [3 H] -timidina (según las necesidades de la cepa). Después del crecimiento hasta la fase logarítmica, las células se recogen y lisan y se aísla el ADN total. Una muestra del ADN aislado se centrifuga en un gradiente de bromuro de etidio-cloruro de cesio para separar el plásmido del ADN cromosómico. Después de la centrifugación, el tubo de centrífuga se perfora en su parte inferior, las fracciones se recogen en discos de filtro y el ADN se precipita en los filtros mediante tratamiento con ácido tricloroacético (TCA) y etanol. Los filtros se secan y se cuentan en un espectrómetro de centelleo. Una gráfica de número de fracción vs. cpm podría producir un perfil como el que se muestra en la Figura 6.1. El pico más pequeño, centrado en la fracción número 12, representa el ADN plasmídico, que, en una forma superenrollada, es más denso que el ADN cromosómico cortado centrado en la fracción número 26.

Figura 6.1. Fracciones recogidas de un gradiente de bromuro de etidio-cloruro de cesio que separa el plásmido del ADN cromosómico. Las células se cultivan en presencia de timina o timidina radiactiva de modo que el ADN en replicación se marque con el isótopo de tritio. El ADN plasmídico superenrollado, centrado alrededor de la fracción 12, sedimenta a una densidad más alta que el ADN cromosómico cizallado, centrado alrededor de la fracción 26.

El número de copias de plásmido se calcula utilizando la siguiente relación:

Problema 6.3

Un experimento para determinar el número de copias de un plásmido de 6000 pb en E. coli se realiza como se describió anteriormente. Se encuentra que la principal fracción que contiene plásmidos contiene 25 000 cpm. La fracción máxima cromosómica contiene 220 000 cpm. ¿Cuál es el número de copias del plásmido?

Solución 6.3

El primer paso para resolver este problema es calcular los pesos moleculares del plásmido y el E. coli cromosoma. El plásmido tiene 6000 pb. los E. coli El cromosoma tiene aproximadamente 4,6 millones de pb de longitud. Sus pesos moleculares se calculan utilizando el factor de conversión de 660 daltons / bp.

El peso molecular del plásmido es

El peso molecular del E. coli el cromosoma es

Estos valores se pueden incorporar a la ecuación (antes de este problema) para calcular el número de copias:


Contenido

Esther M. Lederberg y Luigi L. Cavalli-Sforza descubrieron "F", [5] posteriormente publicando con Joshua Lederberg. [6] Una vez que se anunciaron sus resultados, otros dos laboratorios se unieron a los estudios. "Este no fue un descubrimiento independiente simultáneo de F (lo denomino Factor de fertilidad hasta que se entendió). Le escribimos a Hayes, Jacob y Wollman, quienes luego procedieron con sus estudios". [7] El descubrimiento de "F" a veces se ha confundido con el descubrimiento de William Hayes del "factor sexual", aunque nunca reclamó la prioridad. De hecho, "él [Hayes] pensó que F era realmente lambda, y cuando lo convencimos [de que no lo era], comenzó su trabajo". [8]

Los segmentos funcionales más comunes que constituyen factores F son: [9]

  • OriT (Origen de la transferencia): La secuencia que marca el punto de partida de la transferencia conjugativa.
  • OriV (origen de la replicación vegetativa): la secuencia a partir de la cual se replicará el ADN plásmido en la célula receptora.
  • tra-región (genes de transferencia): genes que codifican el proceso de transferencia de ADN y F-Pilus.
  • IS (Elementos de inserción) compuestos por una copia de IS2, dos copias de IS3 y una copia de IS1000: los denominados "genes egoístas" (fragmentos de secuencia que pueden integrar copias de sí mismos en diferentes ubicaciones). [10]

Algunos genes del plásmido F y su función:

El episoma que alberga el factor F puede existir como un plásmido independiente o integrarse en el genoma de la célula bacteriana. Hay varios nombres para los posibles estados:

  • Bacterias Hfr poseen todo el episoma F integrado en el genoma bacteriano.
  • Bacterias F + poseen factor F como plásmido independiente del genoma bacteriano. El plásmido F contiene solo ADN del factor F y no contiene ADN del genoma bacteriano.
  • Bacterias F '(F-prime) se forman por una escisión incorrecta del cromosoma, lo que da como resultado el plásmido F que lleva secuencias bacterianas que están al lado de donde se insertó el episoma F.
  • F - bacterias no contienen factor F y actúan como destinatarios.

Cuando una célula F + se conjuga / se acopla con una célula F -, el resultado son dos células F +, ambas capaces de transmitir el plásmido a otras células F - por conjugación. Un pilus en la célula F + interactúa con la célula receptora permitiendo la formación de una unión de apareamiento, el ADN se corta en una hebra, se desenrolla y se transfiere al receptor. [3] [9]

El plásmido F pertenece a una clase de plásmidos conjugativos que controlan las funciones sexuales de las bacterias con un sistema de inhibición de la fertilidad (Fin). En este sistema, un factor de acción trans, FinO, y ARN antisentido, FinP, se combinan para reprimir la expresión del gen activador TraJ. TraJ es un factor de transcripción que regula al alza la tra operón. los tra El operón incluye genes necesarios para la conjugación y la transferencia de plásmidos. Esto significa que una bacteria F + siempre puede actuar como una célula donante. los finO El gen del plásmido F original (en E. coli K12) se interrumpe por una inserción IS3, lo que resulta en tra expresión del operón. [11] [12] Las células F + también tienen las proteínas de exclusión de superficie TraS y TraT en la superficie bacteriana. Estas proteínas previenen eventos secundarios de apareamiento que involucran plásmidos que pertenecen al mismo grupo de incompatibilidad (Inc). Por tanto, cada bacteria F + puede albergar sólo un tipo de plásmido de cualquier grupo de incompatibilidad dado.

En el caso de la transferencia de Hfr, los transconjugados resultantes rara vez son Hfr. El resultado de la conjugación Hfr / F - es una cepa F - con un nuevo genotipo. Cuando los plásmidos F-prime se transfieren a una célula bacteriana receptora, transportan fragmentos del ADN del donante que pueden volverse importantes en la recombinación. Los bioingenieros han creado plásmidos F que pueden contener ADN extraño insertado, lo que se denomina cromosoma artificial bacteriano.

La primera ADN helicasa jamás descrita está codificada en el plásmido F y es responsable de iniciar la transferencia del plásmido. Originalmente se llamaba E. coli ADN Helicasa I, pero ahora se conoce como Plásmido F TraI. Además de ser una helicasa, el aminoácido de 1756 (uno de los más grandes en E. coli) La proteína TraI del plásmido F también es responsable de la unión al ADN monocatenario específico y no específico, así como de catalizar el corte del ADN monocatenario en el origen de la transferencia.


Materiales y métodos

Colección de plásmidos

Nuestra colección incluía todos los plásmidos completos (con el estado & # x201Cassembled molécula & # x201D) de A. baumannii disponible en las bases de datos de RefSeq y GenBank (NCBI) el 14 de agosto th , 2017. Analizamos los archivos GenBank y fasta con el módulo SeqIO Biopython (Cock et al., 2009) en Python 2.7 para todos los análisis posteriores.

Para aumentar la diversidad de nuestra colección de plásmidos, obtuvimos las secuencias genómicas completas de 10 aislados mexicanos utilizando las plataformas PacBio RSII e Illumina NextSeq. Las secuencias del genoma de tres aislamientos, a saber, 7804, 810CP y 3207, han sido previamente informadas por algunos de los autores de este manuscrito (Castro-Jaimes et al., 2016 P & # x00E9rez-Oseguera et al., 2017).

Para los otros ocho aislamientos, construimos ensamblajes híbridos con lecturas de ambas plataformas usando SPAdes v3.9.0 o Unicycler v0.4.1 (Bankevich et al., 2012 Wick et al., 2017). Realizamos la anotación funcional con el canal de anotación del genoma procariótico del NCBI. Los números de acceso de GenBank de los genomas de los aislados mexicanos se enumeran en la Tabla complementaria S10. Por lo tanto, en total, analizamos 173 plásmidos completos, y la lista completa de plásmidos y cepas se muestra en la Tabla complementaria S1.

Delimitación del linaje plasmídico

Realizamos búsquedas BLASTn emparejadas (Camacho et al., 2009) entre los 173 plásmidos completos de nuestra colección. Construimos diferentes redes de plásmidos, cada una basada en un rango definido de cobertura (del 40 al 90%). Para cada par de plásmidos, colocamos un enlace entre los plásmidos si el plásmido más pequeño cubría al menos un porcentaje definido del otro plásmido, donde la cobertura se determinó por la suma de las longitudes de alineación con una identidad superior al 90% Luego, extrajimos las islas o & # x201C componentes conectados & # x201D con NetworkX (Hagberg et al., 2008) en Python 2.7. Para cada componente conectado, extrajimos el plásmido más conectado (concentrador) para usarlo como referencia. Cuando había más de un concentrador, los clasificamos por tamaño y seleccionamos el plásmido más grande. Los linajes de plásmidos y las referencias asociadas se enumeran en la Tabla complementaria S1.

Extracción de proteínas de replicación de plásmidos

Usamos un enfoque basado en anotaciones para extraer las proteínas de replicación de iniciación del plásmido. Mediante el uso de los archivos de plásmido GenBank, realizamos una búsqueda que no distingue entre mayúsculas y minúsculas de las siguientes palabras clave en los productos: & # x201Creplication protein & # x201D, & # x201Cplasmid replication iniciator & # x201D, & # x201Cplasmid replication & # x201D, & # x201CDNA replication & # x201D , & # x201C replicasa de plásmido & # x201D, & # x201Creplication a & # x201D, & # x201Creplication b & # x201D, & # x201Creplication c & # x201D, & # x201CRepB & # x201D, & # x201 x201Creplicación & # x201Crolling circle, & # x201Crolling circle & # x201D # x201Creplicase & # x201D. Luego, extrajimos las secuencias de nucleótidos y proteínas y excluimos genes parciales y pseudogenes. Además, extrajimos 500 nucleótidos corriente arriba y corriente abajo del gen Rep para análisis adicionales. Todo este proceso se realizó con Python 2.7 y el módulo Biopython SeqIO (Cock et al., 2009).

Proteínas de referencia para la designación de grupo de homología

Compilamos todas las proteínas de replicación (Rep) que fueron informadas por Bertini et al. (2010) (Bertini et al., 2010) por nombre del gen, nombre del plásmido y número de acceso del plásmido cuando esté disponible. Para aquellos casos en los que las proteínas Rep no tenían una etiqueta de locus o un nombre de gen, agregamos una etiqueta de locus artificial construida con el ID del replicón y el nombre de la replicasa. Cuando el nombre de la réplica no estaba disponible, asignamos la palabra & # x2018rep & # x2019 seguida de un número en el orden de aparición en el archivo GenBank para distinguir entre réplicas. En algunos casos, cuando había dos proteínas de replicación en el mismo plásmido, para asignar correctamente estas proteínas como referencias para ciertos grupos de homología, realizamos una búsqueda BLAST de estas proteínas contra la base de datos GenBank nr para identificar los hits correspondientes fuera de la Acinetobacter género informado en la Tabla complementaria S1 en Bertini et al. (2010). No se pudieron identificar dos proteínas: la Aci3 replicasa del plásmido Ab599 (miembro de GR3), porque la secuencia del plásmido no estaba depositada en bases de datos, y la Aci2 replicasa del plásmido MAD, porque el plásmido tenía una secuencia parcial que no incluía la replicase. Por lo tanto, omitimos estas proteínas de nuestros análisis y examinamos a otros miembros de los mismos grupos de homología en su lugar. Como informaron Lean y Yeo (2017), el grupo de homología GR2 debe dividirse en dos grupos, por lo tanto, separamos las proteínas que representan GR2 de las del GR20 recién formado. Además, (Cameranesi et al., 2017) informaron recientemente nuevos grupos de homología, por lo que descargamos los plásmidos que albergaban las réplicas que representan estos grupos y extrajimos esos genes. La Tabla complementaria S2 enumera todas las proteínas utilizadas como referencias en este trabajo, incluidos los orígenes, accesiones, números y encabezados utilizados en los archivos multi-FASTA incluidos en los Materiales complementarios S1, S2.

Asignación de grupos de homología para proteínas rep

En primer lugar, realizamos búsquedas BLASTn emparejadas (Camacho et al., 2009) entre todos los genes que codifican las proteínas de iniciación de la replicación presentes en nuestra colección de plásmidos. Conservamos los hits con más del 74% de identidad de nucleótidos y eso cubría al menos el 90% de la consulta. Luego, si la secuencia de codificación de la consulta (CDS) se asignaba a un solo grupo de homología, designamos la secuencia como perteneciente a ese grupo, mientras que si había más de un resultado para diferentes grupos de homología, asignamos la consulta al GR con el mayor porcentaje de identidad. Descartamos el grupo de homología GR23 porque la referencia asociada (KY984047_repAci23) era 100% idéntica a una de las referencias de GR8 (GU979000.1_p11921_repA).

Análisis filogenético de la proteína plasmídica rep y designación de nuevos grupos de homología

Creamos una red en la que cada gen que codificaba una proteína Rep estaba conectado a otro si los dos genes compartían al menos el 74% de identidad de nucleótidos y el 90% de cobertura. Luego, para las islas o componentes conectados que no tenían una proteína Rep en la tabla de referencia, seleccionamos el centro como referencia y lo agregamos a la Tabla complementaria S1. Además, construimos filogenias de proteínas de iniciación de replicación de plásmidos para validar las asignaciones actuales y los nuevos grupos de homología. Buscamos los dominios de Pfam asociados en la base de datos de Pfam (El-Gebali et al., 2019), consultada el 21 de febrero. S t , 2018, para separar las proteínas por dominios conservados y realizar alineaciones por separado porque estas proteínas son muy diferentes. Usamos Clustal Omega (Sievers et al., 2014) para alinear aminoácidos y RevTrans (Wernersson y Pedersen, 2003) para guiar la alineación de nucleótidos por el CDS traducido. Luego, ejecutamos jModelTest2 (Darriba et al., 2012) para buscar un modelo evolutivo adecuado y construimos el árbol filogenético con PHYML (Guindon y Gascuel, 2003) con el modelo seleccionado. Mediante inspección visual, validamos las referencias de nuevos grupos de homología, proteínas seleccionadas que pueden ser representativas de nuevos clados y designamos estas proteínas como nuevos grupos de homología, como se detalla en la Tabla complementaria S2.

Análisis filogenético de proteínas ribosómicas y MLST

Usamos Roary (Page et al., 2015) para extraer genes de monocopia que codifican proteínas ribosomales que pertenecen al genoma central y que tenían exactamente el mismo tamaño en todas las cepas para evitar huecos en la alineación. Alineamos las proteínas ribosomales con Clustal Omega (Sievers et al., 2014) para guiar la alineación de nucleótidos con RevTrans (Wernersson y Pedersen, 2003). Descartamos secuencias con señales de recombinación detectadas con RDP4 (Martin et al., 2015). Concatenamos las alineaciones de nucleótidos restantes con FASconCAT-G (K & # x00FCck y Longo, 2014) y usamos jModelTest2 (Darriba et al., 2012) para seleccionar el modelo evolutivo para construir un árbol filogenético con PHYML (Guindon y Gascuel, 2003). Usamos las proteínas ribosomales del Acinetobacter haemolyticus Cepa CIP 64.3 como un grupo externo. La asignación de tipo de secuencia (ST) de cada A. baumannii aislados, bajo los esquemas Oxford y Pasteur MLST, se obtuvieron de la base de datos PubMLST 1 (Bartual et al., 2005 Diancourt et al., 2010).

Identificación de sistemas de secreción, genes de resistencia a antibióticos y secuencias de inserción en plásmidos

Usamos MacSyFinder con los perfiles TXSSCAN (Abby y Rocha, 2017) para identificar sistemas de secreción en la colección de plásmidos y ResFinder para identificar los genes de resistencia a antibióticos adquiridos presentes en nuestro conjunto de plásmidos (Zankari et al., 2012). Identificamos los elementos de la secuencia de inserción (IS) presentes en los plásmidos utilizando la base de datos ISfinder en 2 (Siguier et al., 2006).

Identificacion de pdif Sitios (XerC / D y Xer D / C) en plásmidos

Para identificar el pdif sitios en nuestro conjunto de plásmidos, hicimos un análisis BLASTn utilizando como consultas las pdif sitios del plásmido pS30-1: XerC / D, ATTTCGTATAAGGTGTATTAT- GTTAATT y XerD / C, ATTTAACATAATGGCTGTTATGCGAAAC (Blackwell y Hall, 2017).

Asignaciones COG

Determinamos las asignaciones de genes homólogos para cada plásmido en función de las búsquedas del modelo de Markov oculto (HMM) utilizando el hmmsearch programa (Eddy, 2011). Este proceso de búsqueda HMM emplea un conjunto de modelos previamente construido que representa cada uno de los 4873 COG y 8539 Grupos Ortólogos Remanentes (ROG) (Tatusov et al., 2003 Taboada et al., 2010). Luego, usando scripts de Perl, clasificamos cada COG asignado usando el esquema de clasificación general de Tatusov [66]. Calculamos la frecuencia de cada gen por clase y graficamos los resultados usando los scripts ggplot2 R 3 (Wickham, 2009).


PCURE: Dirigirse a plásmidos para reducir la carga de resistencia a los antibióticos

Las infecciones resistentes a los antibióticos han sido reconocidas como un importante problema de salud mundial que se está intensificando debido a la falta de enfoques novedosos y concretos para combatirlas. Los plásmidos son reconocidos como uno de los principales contribuyentes a la rápida propagación mundial de genes de resistencia. Sin embargo, actualmente se están siguiendo pocas estrategias que se dirijan específicamente a los plásmidos. Nuestro trabajo consiste en desarrollar formas de desplazar los plásmidos de sus huéspedes utilizando funciones de incompatibilidad sin interrumpir la viabilidad celular mediante la neutralización de los sistemas de toxina / antitoxina codificados por plásmidos. Este enfoque es prometedor in vitro resultados, pero necesita un mayor desarrollo y reconocimiento como una opción viable para combatir el problema de la resistencia.

La presencia generalizada actual de bacterias multirresistentes (MDR) se ha convertido en una carga importante para los servicios de salud nacionales, con un aumento de las tasas de mortalidad debidas a infecciones bacterianas. Uno de los factores que contribuye en gran medida al problema es la rapidez con que los determinantes de resistencia nuevos y existentes se mueven entre los huéspedes bacterianos. Muchas cepas de patógenos exitosas a nivel mundial han podido difundirse ampliamente como resultado de genes de resistencia adquiridos en elementos genéticos móviles (MGE) (1). This rapid spread is in part due to the extensive movement of people, goods and animals for example, all of which allow for the interaction between different bacterial strains and their MGEs, resulting in a globalized gene pool (2).

Plásmidos

Joshua Lederberg first coined the term “plasmid” in 1952 (3), and since their discovery as “extra-chromosomal hereditary determinants”, studies have highlighted their role in horizontal gene transfer (HGT) and usefulness as tools in molecular biology. Much of the early work on plasmids focused on the observation that resistance to antibiotics seemed to transfer from one strain to another, leading to the description of R-factors (4, 5). However, in the early 1970s, Stanley Falkow, Stanley Cohen, Herbert Boyer, Donald Helinski, Charles Brinton and several others developed the concept of using plasmids as tools for gene cloning. The discovery that plasmids could be efficiently used as cloning vectors led to an increased interest in understanding plasmid biology, as well as stimulating new types of biotechnology.

Plasmids are typically circular (but also less commonly linear) double-stranded DNA molecules that are able to independently control their multiplication and stable inheritance from generation to generation in their bacterial h osts (2). In addition, many plasmids can transfer from one bacterium to another, the most sophisticated mechanism being by conjugation in which the plasmid carries genes that can create a bridge between bacteria through which a copy of the plasmid can move (Fig 1a). Some plasmids are not able to do this on their own, but can use the bridge made by other plasmids to transfer themselves. The set of genes for multiplication, stable inheritance and transfer are called the plasmid backbone or core. Plasmids can also pick up a variable cargo of other genes that can help their host bacterium grow or survive in different environments – the plasmid spreads them between bacteria and if a survival advantage is gained due to the carried genes on the plasmid there will be positive selection for its carriage. Amongst the favourable traits carried on plasmids, genes conferring antibiotic resistance are of particular concern in the spread of drug-resistant infections (6).

Although all plasmids basically function in similar ways, what makes targeting plasmids difficult is that the genes and proteins they need for multiplication and stable inheritance are highly diverse making it unlikely to find a single compound that will block them all.

Dominant plasmids

The role of plasmids, particularly those able to transfer autonomously (conjugative), in the spread of antibiotic resistance was quickly established. But it was not until techniques like DNA sequencing became commonplace that the extent of the role plasmids play in the dissemination and evolution of resistance traits became clear (7). Genetically identical plasmids were identified globally in different, completely unrelated strains of bacteria. Genes such as NDM-1 conferring resistance to β -lactam antibiotics, and other essential antibiotics, have been observed on dominant plasmid types that are known to have been in circulation for over 50 years. For example, resistance determinants on one type of plasmid isolated from outbreaks of disease caused by E. coli in Canada were also identified only a few years later on different plasmid backbones in outbreaks of K. pneumoniae infection in Sweden . It appears that past antibiotic usage has selected certain plasmids, which are then more likely to pick up the next resistance gene that comes along.

Incompatibility and toxin/anti-toxin systems

All plasmids have ways to control their multiplication so that they do not become a burden to their host bacterium. Closely related plasmids that use the same or similar multiplication genes will therefore compete with each other and cannot be stably inherited together. This is called plasmid “incompatibility” and has been historically used to classify plasmids into different incompatibility groups – plasmids that compete with each other are classified into the same incompatibility group (11). As DNA sequencing technologies developed it became clear that groups of incompatible plasmids shared key parts of their backbones and could be identified by PCR methods . Another class of evolutionary adaptation to ensure stable inheritance inside a host are the toxin/anti-toxin (TA) systems. Many plasmids carry such TA systems, which are usually composed of a stable toxin and an unstable anti-toxin. This means that if the plasmid is lost, the stable toxin outlives the unstable anti-toxin, resulting in death or reduced viability of the plasmid-free cell, and thus maintenance of the plasmid within the overall population (14).

Plasmid curing

As the problem of antibiotic resistance grows, and the number of new antibiotics fails to provide a solution, novel approaches are required to tackle the issue. Since the initial discovery of plasmids, efforts have been made to eliminate, or “cure”, them from their hosts in order to better understand the biological role that these elements have. Early attempts to eliminate plasmids by Salisbury et al. (15) involved stressing the host either by growing the bacterium at higher than optimal temperatures, or by adding chemical compounds such as acridine orange, sodium dodecyl sulfate (SDS) or ethidium bromide. These interventions were only successful for some plasmids and generally also resulted in mutations and damage to the host. Approaches such as these are also not amenable to use in curing plasmids beyond the laboratory.

As more was learned about plasmid replication in the 1970s and with the development of gene cloning, plasmid regions that specifically interfered with stable inheritance were discovered. Different groups, including Hynes et al. (16), developed techniques that relied on identifying the incompatibility groups of the target plasmids and then introducing plasmids with the same incompatibility group to induce curing. This technique was refined by Stolt et al. (17), who cloned only the specific regions that determine incompatibility onto a vector, and showed that this could cure a plasmid carried by Mycobacterium fortuitum. Uraji et al. (18) refined the work of Stolt et al. (1996), by cloning the replication functions to induce incompatibility onto a vector carrying a gene that could be induced to self-destruct. This allowed for the selection of completely plasmid-free strains.

Although the mentioned studies demonstrated the feasibility of using incompatibility to stably cure plasmids from bacterial populations, using this, as an alternative approach to deal with increasingly antibiotic resistance strains was first truly conceptualized in a patent application filed by Filutowicz (19).

Denap et al. (20) took the concept of incompatibility and used it as a rationale to test small chemicals that specifically target functions required for plasmid replication. They used aminoglycosides, which are known to target RNA, and tested their ability to block the replication of plasmids that use RNA as control elements during replication. Their studies showed that when using these drugs a bacterial population could be re-sensitized. However, using antibiotics to try and reduce the problem of antibiotic resistance is not an optimal strategy and many plasmids carry aminoglycoside resistance genes. Nevertheless, it brought forward the concept that plasmids could be a good target for new therapeutic strategies, an idea which was supported by Latha et al. (21) who isolated plant extracts with anti-plasmid properties.

More recently, several groups including ours have looked at ways to specifically target plasmids that carry antibiotic resistance using genetic techniques. Bikard et al. (22) and Ji et al. (23) used CRISPR-Cas to design target-specific systems delivered either by bacteriophages (22) or conjugative plasmids (23). These approaches highlight how genetic techniques can be used instead of chemical compounds as antimicrobials and warrants further development alongside approaches such as phage therapy.

PCURE

The presence of large antibiotic resistance plasmids in bacterial populations is the major determinant of poor clinical outcome during hospital-acquired infections (HAI). Vulnerable or immunocompromised patients commonly suffer from HAIs when bacteria that are normally carried in the gut or on the skin infect wound sites following surgery or form biofilms on indwelling devices such as ventilators and catheters leading to pneumonia or UTIs (Fig. 2). Due to the facility with which plasmids can transfer among bacteria, including gut bacteria, developing a system whose purpose is to displace antibiotic resistance plasmids from particular environments could be a good approach to reduce the burden of antibiotic resistance.

T he pCURE system was developed in the Thomas laboratory by combining functions to block replication of a target plasmid whilst also neutralizing any TA system it carries (Fig. 1b). These “curing functions” are cloned into a different vector that is not itself incompatible with (and therefore blocked by) the target plasmid(s). The combination of targeting multiple replicons and neutralizing TA systems makes our approach unique and essential for applications in environments where one would not want to disrupt the normal ecological balance. For example, it could provide a clear advantage over antibiotic treatment, which can often disrupt the gut microbiota and can result in overgrowth of resistant pathogens such as C. difficile. Hale et al. (24) showed that the pCURE system could be engineered and applied to target different types of plasmids and that it cured at very high efficiency. Although useful in an in vitro setting as shown by several groups who used the system to cure important resistance plasmids (25, 26), the pCURE described by Hale et al. (24) could not be used in more complex environments because it is not self-transmissible.

Currently work in our group is being undertaken to develop a pCURE system that is self-transmissible and could therefore spread among complex microbial communities, displacing antibiotic resistance plasmids as it does so (Fig. 1c). To achieve this goal we are using conjugative IncP-1 plasmids as the core of our vector because of their very broad host range (27) allowing efficient spread through complex communities. We have so far shown that these conjugative pCURE plasmids can transfer, invade and displace an IncF plasmid from a bacterial population in the absence of external selection (Lazdins et al. unpublished results). Work is currently ongoing to expand the curing potential to target a range of natural antibiotic-resistance plasmids and to optimize transfer rates.

Future work and applications for pCURE

In countries where general rates of antibiotic resistance are low (e.g., The Netherlands) it is common practice that all patients entering intensive care units (ITUs) undergo selective digestive and/or oropharyngeal decontamination (SDD and SOD) (28). These involve the administration of prophylactic antibiotics in order to try and reduce the prevalence of infections that would lead to increased mortality. Although effective in decreasing the mortality rates (29), the disruption caused to the normal flora and the possible development of further antibiotic-resistant strains is not ideal. Our vision for pCURE is that it could be used as a prophylactic measure in a similar way to SDD or SOD, given to patients who enter healthcare settings. By giving pCURE to patients at risk of developing infections upon admission to hospital, the idea is that if an infection develops, then it is more likely for it to be sensitive to standard antibiotic therapy, due to displacement of the plasmids carrying resistance (Fig. 2). This can also be applied to healthcare workers to limit possible spread of any antibiotic-resistant strains that they may be carrying.

Another area where we think that pCURE would be particularly useful is in limiting the international spread of resistance. There are places where the number of strains carrying plasmids with multiple antibiotic resistance genes is higher than others (Southeast Asia vs. Scandinavia for example) and studies have demonstrated that individuals travelling to places with higher occurrence will quickly be colonized by resistance strains even without becoming ill and these strains can remain in their flora for extended periods (30). Therefore, upon returning from places with a high risk of colonization, travellers could take a course of pCURE to eradicate any problematic resistance genes they have acquired. For this vision to be realised several steps need to be taken to ensure that pCURE becomes a cost-efficient, adaptable and, most importantly, safe system to use in human medicine.

Bacterial conjugation in the gastrointestinal tract (GIT) of humans is poorly understood, and although there is evidence that conjugation is an important factor influencing HGT in the GIT (See (31)) for a current review), more work will be needed to fully understand the extent of pCURE spread once administered. These studies will require the use of animal models or complex in vitro gut models. Once these studies are done, more work can be undertaken to optimize pCURE as a transfer agent, but also to find the best way to administer it. We are currently taking inspiration from probiotics and faecal transplant treatments, where in both cases live bacteria are successfully delivered to the gastrointestinal tract.

Safety considerations are essential when establishing how best to administer pCURE and track how it spreads. Plasmids have the ability to pick up resistance genes extremely easily as well as having the ability to integrate into bacterial-host chromosomes. To ensure safety and avoid fears of releasing genetically modified elements into nature, we would need to prevent the acquisition of resistance genes by the pCURE vector as well as the potential for chromosomal integration by including genetic safeguards in our system. These would include systems that specifically block the ability of plasmids to acquire extra resistance genes as well introducing specific self-destruct mechanisms to avoid pCURE from working outside of the body.

Extensive discussions will also be needed with safety governing bodies (for example, the FDA or EMA) regarding the classification and requirements for the usage of pCURE. At present, pCURE sits somewhere between a food, a drug and a biologic so specific requirements for trials and approval in human usage will need to be clarified. Alongside this clarification, studies on how the public would perceive pCURE as a product are essential. A lot is known about the reticence that people have for using genetically modified organisms (GMOs) (32, 33), but would this reticence change in the face of the dangers of antibiotic resistance?

Conclusión

Even though plasmids are the major reason for the development and spread of resistance among naïve bacterial populations, very little attention is being given to these elements as targets for combating the maintenance and spread of antibiotic resistance. The knowledge and technology to develop plasmid-curing technologies is accessible, and many groups have used a range of approaches to achieve this goal in vitro. However, the jump to using these kinds of systems in more complex environments has yet to be realized. We believe that the practical value of pCURE should be explored as an efficient way to cure antibiotic-resistance plasmids from strains colonizing the GIT in a way that would not disrupt the normal flora, resulting in a reduced clinical burden if infection were to manifest itself.

Biografias

Dr Claire Miller gained her PhD in Bacterial Genetics from the University of Leicester, followed by a three year post-doctoral research position in the same laboratory. She is currently working in the laboratory of ProfessorThomas at the University of Birmingham. She joined the laboratory on a Wellcome Trust ISSF Translational Award to develop plasmid curing as a method for reducing antibiotic resistance carriage in bacteria.

Dr Mark A Webber is interested in the study of the mechanisms and biology of antibiotic resistance, bacterial responses to stress and biofilm formation and has published over 50 articles in these areas since 2001. He was awarded a BBSRC David Phillips Fellowship in 2007 and took up a tenured position within the Institute for Microbiology and Infection at Birmingham at the beginning of 2012.

 Professor Christopher M Thomas is Professor of Molecular Genetics in the School of Biosciences and Institute of Microbiology and Infection at the University of Birmingham. He has been passionate about bacterial plasmids as systems ever since his DPhil in Oxford with Keith Dyke and postdoc with Donald Helinski at University of California, San Diego. He led the creation of the International Society for Plasmid Biology in 2004 and set up Plasgene in 2006 based on plasmid curing technology.


How Much Do You Know About the Prokaryotic Expression System?

E. coli protein expression system is the most commonly used expression system for recombinant proteins. Prokaryotic expression vectors generally consist of the replicon, promoters, selection markers, multiple cloning sites (MCS) and fusion tags / restriction sites.


The replicon is comprised of the origin of replication (ORI) and all of its control elements. The ORI is the place where DNA replication begins, enabling a plasmid to reproduce itself as it must to survive within cells. The best choice of ORI depends on how many plasmid copies you want to maintain, which host or hosts you intend to use, and whether or not you need to consider your plasmid's compatibility with one or more other plasmids. Commonly used pET (Novagen) series vectors mainly carry pMB1 ori, providing a copy number of 15-60 pQE vectors (Qiagen) carrying ColE1 ori provides a copy number of 15-20 pACYC and pBAD series of vectors carry p15A ori, giving a copy number of 10-12, and are commonly used for the co-expression of two recombinant proteins. (Misunderstanding: Does high copy number of the carrier result in high protein expression yield? High copy of the exogenous plasmids will create a greater burden on the normal metabolism of the host, which may slow down cell proliferation, destabilize the plasmid, and eventually compromise the final expression yield of the recombinant protein.) This following table defines common cloning vectors, their copy number, ORI, and incompatibility groups.

Table 1. Common Prokaryotic Expression Vectors and ORIs


Cullum, J., Collins, J. F., Broda, P.: Factors affecting the kinetics of progeny formation with F'lac in Escherichia coli K12. Plásmido 1, 536–544 (1978a)

Cullum, J., Collins, J. F., Broda, P.: The spread of plasmids in model populations of Escherichia coli K12. Plásmido 1, 545–556 (1978b)

Cullum, J., Broda, P.: Rate of segregation due to plasmid incompatibility. Gineta. Res. 33, 61–79 (1979)

Finger, J., Krishnapillai, V.: Host range, entry exclusion, and incompatibility of Pseudomonas aeruginosa FP plasmids. Plásmido 3, 332–342 (1980)

Ishii, K., Kashimoto-Gotoh, T., Matsubara, K.: Random replication and random assortment model for plasmid incompatibility in bacteria. Plásmido 1, 435–445 (1978)

Nordström, K., Molin, S., Aagaard-Hansen, H.: Partitioning of plasmid R1 in Escherichia coli. I. Kinetics of loss of plasmid derivatives deleted of the par region. Plásmido 4, 215–227 (1980)

Nordström, K., Aagaard-Hansen, H.: Maintenance of bacterial plasmids: comparison of theoretical calculations and experiments with plasmid R1 in Escherichia coli. Mol. Gen. Genet. 197, 1–7 (1984)

Novick, R. P., Hoppensteadt, F. C.: On plasmid incompatibility. Plásmido 1, 421–434 (1978)

Simmons, G. F.: Introduction to topology and modern analysis. McGraw-Hill, New York 1963

Stewart, F. M., Levin, B. R.: The population biology of bacterial plasmids: a priori conditions for the existence of conjugationally transmitted factors. Genética 87, 209–228 (1977)

Van der Hoeven, N. A mathematical model for the co-existence of incompatible, conjugative plasmids in individual bacteria of a bacterial population. J. Theor. Biol. 110, 411–423 (1984)

Van der Hoeven, N.: Evolution of bacterial surface exclusion against incompatible plasmids. J. Theor. Biol. 117, 431–452 (1985)

Willetts, N., Maule, J.: Interaction between the surface exclusion systems of some F-like plasmids. Gineta. Res. 24, 81–89 (1974)


Ver el vídeo: enzimas restricción plásmido DNA recombinante biología molecular biology (Julio 2022).


Comentarios:

  1. Nikotaur

    Tu !!!! Hemos ganado :)

  2. Kigadal

    En mi opinión estás equivocado. Ingrese lo discutiremos. Escríbeme en PM, hablaremos.

  3. Mlynar

    Estas equivocado. Puedo defender la posición. Escríbeme en PM, hablaremos.

  4. Shan

    Qué palabras necesarias ... genial, el brillante pensamiento

  5. Saeger

    un blog es solo una parte de la vida, y cuando no hay tiempo para escribir en un blog, significa que todo el tiempo se dedica a otras cosas no menos agradables.

  6. Dizilkree

    Las discusiones siempre son buenas, pero recuerde que no se pueden confiar en todas las opiniones. A menudo en temas muy serios y complejos, los comentarios son insertados por niños, a veces conduce a un callejón sin salida. Sin duda, sucede que los mismos escolares pueden dar buenos consejos. Pero esta es más la excepción que la regla.



Escribe un mensaje