Información

La proteína de unión a ARN específica más pequeña, ¿con secuencia?

La proteína de unión a ARN específica más pequeña, ¿con secuencia?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy buscando fusionar sintéticamente una proteína de unión a ARN con otra proteína, dentro de un vector viral que tiene un límite de tamaño. He considerado algunas opciones, pero me pregunto qué dirá StackExchange. ¿Cuál es la proteína más pequeña conocida que se une a una secuencia específica de ARN y cuál es esa secuencia?


Unión generalizada de ARN por proteínas asociadas a la cromatina

La evidencia reciente sugiere que la interacción del ARN puede regular la actividad y localización de las proteínas asociadas a la cromatina. Sin embargo, se desconoce si estas observaciones son instancias especializadas para algunos ARN clave y factores de cromatina en contextos específicos, o un mecanismo general subyacente al establecimiento del estado de la cromatina y la regulación de la expresión génica.

Resultados

Aquí, realizamos inmunoprecipitación de ARN de formaldehído (fRIP-Seq) para examinar el ARN asociado con un panel de 24 reguladores de cromatina y proteínas de unión de ARN tradicionales. Para cada proteína que se unió de forma reproducible a cantidades mensurables de ARN a granel (90% del panel), detectamos el enriquecimiento de cientos a miles de transcripciones de ARNm y no codificantes.

Conclusión

Para cada proteína, encontramos que los conjuntos enriquecidos de ARN comparten distintas propiedades bioquímicas, funcionales y de cromatina. Por lo tanto, estos datos proporcionan evidencia de una asociación de ARN específica y relevante generalizada a través de diversas clases de complejos modificadores de cromatina.


Introducción

La regulación de la expresión génica puede ocurrir en cada paso durante la transferencia de información genética del ADN a la proteína. La abundancia de transcripciones está regulada por factores de transcripción, marcas epigenéticas como la metilación del ADN y por la descomposición del ARN, que es un mecanismo importante para el control dinámico de la expresión génica. Para traducir el ARNm de manera eficiente en proteína, la localización y la disponibilidad son tan importantes como la abundancia de transcripciones. Además, los cambios cualitativos en el complemento de ARN de la célula, que pueden incluir empalme alternativo, poliadenilación, metilación de ARN y edición de ARN, tienen consecuencias importantes para el destino del ARN y para la composición del proteoma. Estos procesos están regulados dinámicamente por proteínas de unión a ARN (RBP), que han ganado una prominencia cada vez mayor como importantes reguladores postranscripcionales de la expresión génica. Sorprendentemente, se ha estimado que más de 1500 RBP están codificadas por el genoma 1-4 de mamífero.

Las RBP llevan a cabo sus funciones uniéndose a secuencias de ARN o estructuras secundarias a través de diversos motivos de unión de ARN. Algunas RBP se unen a secuencias cortas de una sola hebra dentro del ARNm, incluidos elementos ricos en AU (ARE), elementos ricos en GU o tractos de polipirimidina 5. Las secuencias de ARN específicas pueden interactuar con una variedad de RBP, a veces con funciones opuestas y, por lo tanto, pueden dar como resultado destinos de ARN alternativos, como la estabilización o desestabilización de las transcripciones diana (Fig. 1) 6. El ARE es un motivo de secuencia que se encuentra a menudo en las regiones 3 'no traducidas (3' UTR) del ARNm. Se asocia principalmente con la descomposición del ARN y puede interactuar con múltiples proteínas con diferentes afinidades en el rango nanoMolar (Tabla 1). Mientras que la familia Tristetraprolin (ZFP36) de RBP se une a ARE a través de dominios de dedos de zinc CCCH en tándem, HuR (antígeno humano R) codificado por ELAV1 (visión embrionaria letal anormal como 1), CUGBP1 (proteína de unión a ARN de repetición de triplete CUG 1), AUF1 (AU - factor de unión a elementos ricos 1, también conocido como ribonucleoproteína nuclear heterogénea D de hnRNP D), nucleolina y TIA1 (antígeno intracelular de células T 1) y sus parálogos se unen a través de motivos de reconocimiento de ARN (RRM). Por el contrario, KSRP (proteína reguladora de empalme de tipo KH), Mex3D (Tino) y la proteína 1 relacionada con el retraso mental X frágil (FXR1), se unen a los ARE a través de dominios de homología K (KH), un dominio de proteína que se reconoció por primera vez en el proteína humana hnRNP-K 14, 15.

La unión competitiva del antígeno humano R (HuR) y Tis11 puede dirigir destinos alternativos de ARNm diana. HuR y Tis11 pueden competir por las mismas secuencias de unión, lo que da como resultado destinos de ARNm opuestos. (a) La competencia por la unión al ARNm diana está determinada por la afinidad que tiene cada proteína de unión a ARN (RBP) por las secuencias de unión compartidas. (b) La expresión relativa de estos RBP afectará a la unión competitiva. (c) La regulación postraduccional de RBP, por ejemplo mediante fosforilación, afecta su capacidad para unirse a los ARNm diana.

ARN SON secuencia afinidad de unión nM a TTP afinidad de unión nM a HuR Referencia
A UUU A UUU A UUU A 3·6 7, 8
A UUU A UUU A UUU A UUU A UUU A UUU A 0·5 0·50 9
UU A UUU A UU 3·0 7, 8
U A UUU A U 19·0 7, 8
UUUUUUUU No unido 10
UUUUUUUUU 0·97 10
UUUUUUUUUUUUU 280·0 7, 8
UUUU A UUU A UUUU 3·2 7, 8
UUUU A UUUUUUUU 56·0 7, 8
UUUU A UUU C UUUU 83·0 7, 8
UUUU A UUU GRAMO UUUU 28·0 7, 8
UUUUUUUU A UUUU 54·0 7, 8
UUUU C UUU A UUUU 93·0 7, 8
UUUU GRAMO UUU A UUUU 28·0 7, 8
UU A UUUUUU 130·0 7, 8
UUUUUU A UU 120·0 7, 8
UUUU A U A UUUU 160·0 7, 8
UUUU A UU A UUUU 18·0 7, 8
UUUU A UUU A UUUU 3·2 7, 8
UUUU A UUUU A UUUU 6·4 7, 8
UUUU A UUUUU A UUUU 17·0 7, 8
NN UU NN UUU 0·96 10
U A UU A UUUU 1·14 10
A A UUU A UUU 1·01 10
C UUU C UUU C UUU C UUU C 0·96 10
cFos U A UUU A U A UUUUU A UUUU A UUU 34 11
c-Myc UU A C C A U C UUUUUUUUU C UUU A & gt1000 11
Cox-2 U A UU A A UUU A A UU A UUU A A U A A U A UUU A U A UU A A A 13·6 10
GM-CSF A UUU A UUU A UUU A UUU A UUU A 21 11
IL-1β U A UUU A UUU A UUU A UUU GRAMO UUU GRAMO UUU GRAMO UUUU A UU 0·12 10, 12
IL-2 U A UUU A UUU A A A U A UUU A A A UUUU A U A UUU A UU 44 9·5 10-12
IL-3 U A UUU A UUU A U GRAMO U A UUU A U GRAMO U A UUU A UUU A UUU A U 4 11
IL-8 U A UUU A UU A UUU A U GRAMO U A UUU A UUU A A 1·09 10, 12
TNF-α A UU A UUU A UU A UUU A UUU A UU A UUU A UUU A UUU A 2 0·35 10-12
cFos 3′UTR 10 13
IL-2 3′UTR 32·77 10
TNF-α 3′UTR 3·87 10
  • Constantes de disociación (KD) para interacciones TTP y HuR ARE a 25 ° C. Datos tomados de datos de anisotropía de fluorescencia publicados. Los residuos de adenosina se muestran en rojo, los residuos de citosina y guanina se muestran en azul y norte (cualquier) residuo se muestra en violeta. ARE = ​​elemento rico en adenosina-uridina GM-CSF = factor estimulante de colonias de granulocitos-macrófagos TNF-α = factor de necrosis tumoral alfa IL = interleucina.

La regulación de la estabilidad del ARN proporciona un mecanismo importante mediante el cual se puede controlar la abundancia de diferentes clases de ARN, incluido el ARNm. La primera evidencia de un papel de los ARE en la estabilidad del ARNm se produjo en 1986, cuando se identificaron como secuencias conservadas en la 3'UTR de las transcripciones que codifican citocinas y algunos protooncogenes. Se sabía que estas proteínas estaban codificadas por ARNm con semividas cortas, y se demostró que el ARE de la 3'UTR del ARNm estimulante de colonias de granulocitos y macrófagos (GM-CSF), cuando se incorporaba a una construcción informadora, era una elemento desestabilizador 16. Aproximadamente al mismo tiempo, se reconoció que una secuencia de consenso (TTATTTAT) estaba presente en las 3'UTR del factor de necrosis tumoral (TNF) humano y de ratón y los mRNA de interleucina (IL) -1, así como la linfotoxina humana, colonia- factor estimulante, fibronectina humana y de rata, y casi todos los interferones humanos y de ratón secuenciados en ese momento 17. Como esta secuencia de consenso apareció a un ritmo mayor de lo que dictaría por casualidad, se sugirió que podría tener alguna capacidad reguladora para controlar la magnitud de la respuesta inflamatoria 17. Dos años más tarde, esta hipótesis se confirmó cuando se demostró que estos ARE identificados confieren inestabilidad a una serie de ARNm de citocinas 18. En el mismo año, se demostró que los ARE contenidos en el c-Fos 3'UTR desestabilizan la transcripción y desempeñan un papel fundamental en el proceso de desadenilación [19]. Desde entonces, se ha demostrado que los ARNm que contienen ARE se reclutan selectivamente en la maquinaria de deadenilasa 20, 21. Además, se ha demostrado que la desintegración del ARNm 3′-5 ′ mediada por exosomas es un mecanismo importante de la desintegración del ARNm que contiene ARE 22, 23. Los elementos ricos en AU se encuentran en los ARNm de una amplia gama de especies, incluida la levadura 24, la drosophila 25, el erizo de mar 26 y el ratón, lo que indica que el control de la estabilidad del ARNm a través de las ARE es un proceso regulador conservado que se ha seleccionado durante la evolución 6 .

Algunas RBP reconocen estructuras de ARN secundarias, como el elemento de desintegración constitutivo (CDE), una secuencia de tallo-bucle que se encuentra en más de 100 transcripciones 5. La relación funcional entre los CDE y los ARE en el control de la estabilidad del ARN aún no se ha esclarecido por completo; sin embargo, es probable que cada motivo promueva la descomposición del ARN a través de mecanismos independientes. Un transcrito informador de β-globina, que lleva el 3'UTR de TNF, permaneció lábil en líneas celulares mutantes defectuosas para la desintegración del ARNm mediada por ARE, lo que indica que el TNF 3'UTR contiene un elemento desestabilizador adicional 27. Para analizar esto más a fondo, se transfectaron macrófagos RAW 264.7 de forma estable con un indicador de GFP que comprendía la β-globina 3'UTR, en la que se insertaron TNF ARE o una sección de TNF 3'UTR que se pensaba que contenía un CDE [27]. El tratamiento de estas líneas celulares establemente transfectadas con lipopolisacárido (LPS), o la activación de la señalización de p38 o PI3K en células NIH 3T3, inhibió la desestabilización del ARNm de TNF-α mediada por ARE pero no mediada por CDE 27. El CDE está unido por el RBP Roquin-1 y Roquin-2, que tienen funciones superpuestas en la regulación de la activación de las células T 28-31.


Resultados y discusión

Identificación de todo el genoma de ARNm asociados a BRAT y PUM en Drosophila embriones

Identificar ARNm asociados a BRAT y PUM en Drosophila embriones se realizaron co-inmunoprecipitaciones de ARN seguidas de análisis de microarrays (RIP-Chip). Para las inmunoprecipitaciones, primero generamos anticuerpos sintéticos contra BRAT y PUM usando enfoques de presentación de fagos (ver Métodos). Previamente hemos demostrado que tales anticuerpos, expresados ​​y purificados a partir de E. coli como fragmentos de unión a antígeno (Fab), se pueden utilizar en experimentos de RIP para identificar ARNm asociados a RBP [32, 33]. Después de confirmar la capacidad de estos anticuerpos para inmunoprecipitar BRAT y PUM por western blot (archivo adicional 1), llevamos a cabo experimentos RIP-Chip utilizando extractos preparados a partir de embriones de tipo salvaje recolectados de 0 a 3 h después de la puesta de huevos. Los ARNm asociados se definieron como aquellos que, en tres réplicas biológicas, tenían una tasa de descubrimiento falso (FDR) de menos del 5% y un enriquecimiento promedio de al menos 1,5 veces en los chips BRAT o PUM RIP en comparación con el control negativo RIP- Fichas que utilizan el anticuerpo sintético C1 [32,33].

Se encontró que los ARNm correspondientes a 1.197 genes y 641 genes estaban asociados con BRAT y PUM, respectivamente (Figura 1A y B Archivos adicionales 2 y 3). Nos referimos a estos ARNm asociados como "objetivos" BRAT y "objetivos" PUM. media pensión El ARNm, previamente definido como ARNm diana de PUM y BRAT en embriones tempranos, estaba en ambas listas de diana, mientras que bicoide El ARNm, que ha sido identificado como un objetivo de PUM [34], estaba en la lista PUM pero no en la lista BRAT. Ciclina B El ARNm, un tercer objetivo bien caracterizado de PUM [3,23,24,35], acaba de pasar por alto el límite de la lista de objetivos de PUM (1,4 veces enriquecido en el PUM RIP en comparación con el control negativo, con un FDR & lt10% ) y no estaba en la lista BRAT. Además de regular media pensión ARNm en embriones tempranos, BRAT se ha informado como un represor post-transcripcional putativo de otros ARNm en diferentes tejidos [22, 30, 36]. Uno de estos, dMyc, se expresa en embriones de 0 a 3 h y también estaba en nuestra lista BRAT. Finalmente, 300 (47%) de nuestros ARNm unidos a PUM se superpusieron con una lista de transcripciones previamente identificadas como asociadas con PUM-RBD expresado transgénicamente en ovarios completos [37] (prueba exacta de Fisher PAG value & lt10 −109) (archivo adicional 4). Juntos, estos datos dan confianza a nuestras listas de ARNm asociados a BRAT y PUM.

BRAT y PUM se asocian cada uno con cientos de ARNm en principios Drosophila embriones. (A) BRAT se asocia con ARNm de 1197 genes, y (B) PUM se asocia con ARNm de 641 genes. Los gráficos muestran la intensidad de la señal normalizada por RMA de todas las transcripciones representadas en la micromatriz que se definieron como expresadas en embriones tempranos, en BRAT RIP o PUM RIP frente a Control RIP. Los valores representan promedios de tres réplicas biológicas independientes. Los ARNm con un enriquecimiento medio de al menos 1,5 veces en los RIP BRAT o PUM y con un FDR & lt5% se resaltan en azul o rojo, respectivamente. La línea diagonal continua no representa ningún enriquecimiento y las líneas diagonales discontinuas representan un enriquecimiento o agotamiento de 1,5 veces. (C) Diagrama de Venn que demuestra que existe una superposición modesta pero estadísticamente significativa entre los ARNm asociados con BRAT y con PUM. ** Valor P de la prueba exacta de Fisher & lt10 −13. (D) Gráfico de todas las transcripciones representadas en la micromatriz que se definieron como expresadas en embriones tempranos, que muestra el enriquecimiento de veces en el BRAT RIP-Chip frente al PUM RIP-Chip. Las transcripciones asociadas exclusivamente con BRAT o PUM (es decir, enriquecidas & gt1.5 veces con un FDR & lt5%) se resaltan en azul y rojo, respectivamente, y las transcripciones asociadas con BRAT y PUM se resaltan en verde. Tenga en cuenta que la mayoría de las transcripciones asociadas a BRAT no muestran indicios de enriquecimiento en el PUM RIP-Chip, y viceversa esto se indica además por la correlación negativa de Spearman entre los enriquecimientos de los dos experimentos cuando las transcripciones que se enriquecen en el control en ambos experimentos (es decir, el cuadrante inferior izquierdo de la gráfica) y, por lo tanto, se espera que estén correlacionadas dado que el se utilizó el mismo control en ambos casos, se excluyen: rho de Spearman = −0,188, P & lt10 −37.

BRAT y PUM están asociados con conjuntos de ARNm en gran parte que no se superponen

Para definir hasta qué punto PUM y BRAT comparten objetivos, comparamos nuestras listas de ARNm asociados. Como se describió anteriormente, la cooperación entre BRAT y PUM se ha demostrado en el caso de la represión traslacional de media pensión ARNm, así como una serie de otras transcripciones y, aunque se han identificado funciones independientes de BRAT para PUM y funciones independientes de PUM para BRAT, se desconoce el grado en el que PUM y BRAT cooperan globalmente. De los 1.197 mRNA asociados a BRAT y 641 mRNA asociados a PUM que identificamos, se encontró que 200 estaban asociados con ambas RBP, una superposición estadísticamente significativa (prueba exacta de Fisher PAG value & lt10 −13 Figura 1C). La comparación de nuestros ARNm asociados a BRAT con los identificados como objetivos de PUM-RBD expresado transgénicamente en ovarios completos [37] arrojó resultados similares: una superposición estadísticamente significativa de 190 ARNm (prueba exacta de Fisher PAG value & lt0.01 archivo adicional 4). Ochenta y seis ARNm eran comunes entre las listas de enlaces BRAT, PUM y PUM-RBD. Juntos, estos resultados apoyan la hipótesis de que un número significativo de ARN diana están co-regulados por BRAT y PUM.

A pesar de la superposición estadísticamente significativa de los objetivos PUM y los objetivos BRAT, la mayoría de los objetivos BRAT no estaban sujetos a PUM y viceversa. Para evaluar si esto podría constituir evidencia de que BRAT y PUM también funcionan de forma independiente entre sí en los embriones tempranos, examinamos la correlación entre los enriquecimientos de mRNA en el BRAT RIP-Chip frente al PUM RIP-Chip. Sorprendentemente, la gran mayoría de los ARNm asociados a BRAT no mostraron evidencia de estar asociados con PUM, y la gran mayoría de los ARNm asociados a PUM no mostraron evidencia de estar asociados con BRAT (Figura 1D). De hecho, si dejamos de considerar las transcripciones que fueron enriquecidas en el control RIP en ambos experimentos (y por lo tanto tienden a correlacionarse ya que se usó el mismo control negativo en ambos casos), hubo una fuerte y estadísticamente significativa negativo correlación entre el doble de enriquecimiento de los ARNm restantes (Figura 1D rho de Spearman = −0,188, PAG valor & lt10 −37). Esto es lo contrario de lo que se esperaría si las dos proteínas se unieran principalmente, lo que demuestra claramente que BRAT y PUM se encuentran asociados con mayor frecuencia con diferentes ARNm diana.

Identificación de motivos enriquecidos en ARNm asociados a PUM y BRAT

Para identificar el ARN cis-elemento (s) reconocido por PUM y BRAT en vivo, se utilizó un algoritmo que desarrollamos anteriormente [38] para buscar secuencias contiguas cortas que se predice que sean accesibles a la unión y que estén enriquecidas en ARNm diana de PUM o BRAT en comparación con conjuntos de control negativo de ARNm coexpresados ​​que no están unidos por las respectivas prácticas comerciales restrictivas (ver Métodos).

El análisis de nuestra lista de ARNm asociados a PUM arrojó un motivo, UGUANAKW (N = A / C / G / UK = U / GW = A / U) (Figura 2A) con un área media bajo la característica de funcionamiento del receptor (AUROC) de 0,78 en datos retenidos (consulte Métodos para obtener información sobre AUROC y detalles del procedimiento de validación cruzada, y Archivo adicional 5 para los resultados). Este motivo es casi idéntico al motivo de unión de PUM informado anteriormente [5, 15, 16, 37, 39] y contiene la secuencia invariante 'UGUA' que se encuentra entre los sitios de unión de múltiples proteínas de la familia PUF de una variedad de especies [40]. . Nuestro de novo El descubrimiento del conocido motivo de unión a PUM valida fuertemente nuestra lista de ARNm asociados a PUM.

Motivos de unión a PUM y BRAT. (A) Motivo enriquecido entre los ARNm asociados a PUM, identificado por de novo descubrimiento de motivos. (B) Motivo enriquecido entre los ARNm asociados a BRAT, identificado por de novo descubrimiento de motivos. (C) Comparación del motivo enriquecido entre los ARNm asociados a BRAT con las secuencias de los motivos "Caja A" de los dos media pensión NRE y las cycB NRE. Tenga en cuenta que el motivo Box A de media pensión NRE2 media la represión por BRAT, pero los motivos de Box A de media pensión NRE1 y el cycB NRE no (ver texto). (D) In vitro Motivo de unión a BRAT determinado por RNAcompete usando dominio GST-BRAT-NHL purificado.

El descubrimiento de motivos aplicado a nuestra lista de ARNm asociados a BRAT predijo un motivo con el consenso 'NNUGUUDNN' (D = A / G / U) (Figura 2B) con un AUROC medio de 0,75 en datos retenidos (consulte Métodos para obtener detalles de el procedimiento de validación cruzada y el archivo adicional 5 para los resultados). Recientemente se ha demostrado que BRAT se asocia directamente con media pensión ARN, y su sitio de unión se ha mapeado a las secuencias en y alrededor de la media pensión NRE Casilla A [17]. En particular, nuestro motivo BRAT es una combinación perfecta para el sitio Box A del segundo media pensión NRE si se incluyen los residuos aguas arriba del sitio de la Caja A (UUGUUGU Figura 2C). En contraste, el sitio Box A del primer media pensión NRE carece de la primera U que se encuentra dentro del núcleo UGUU de nuestro motivo (Figura 2C). Estas diferencias se correlacionan con el comportamiento diferencial informado de las dos NRE. in vitro y en vivo: in vitro, el dominio BRAT NHL se une de manera más eficiente al segundo media pensión NRE que el primero, mientras que en los ensayos de reportero de células S2 se requiere el sitio Box A del segundo NRE para la represión traduccional mediada por BRAT, mientras que el sitio Box A del primer NRE tiene una contribución insignificante a esta represión [17]. De manera similar, la secuencia similar a NRE en ciclina B, que carece de la secuencia central UGUU de nuestro motivo BRAT, interactúa y funciona a través de PUM y NOS, pero no BRAT [3]. Tomados en conjunto, estos datos apoyan firmemente la conclusión de que es probable que el motivo de consenso identificado por nuestro análisis computacional sea el De buena fe Sitio de reconocimiento BRAT en vivo.

A continuación, preguntamos si los motivos de consenso que identificamos para PUM y BRAT tendían a estar presentes en la región no traducida 5 '(UTR), marco de lectura abierto (ORF) o UTR 3' de sus transcripciones objetivo. Para abordar esto, determinamos el AUROC para cada motivo de consenso dentro de cada una de estas regiones de las transcripciones objetivo en comparación con los no objetivos coexpresados. Tanto para PUM como para BRAT, su motivo de consenso estaba muy enriquecido en las 3'UTR de sus objetivos (Figura 3A y B AUROC = 0,79). Por el contrario, hubo un menor enriquecimiento de los motivos de consenso en los 5'UTR o los ORF (Figura 3A y B AUROC = 0,55-0,65). Se observó un resultado similar cuando analizamos solo aquellas transcripciones que son co-objetivos tanto de BRAT como de PUM (Figura 3C y D). Esto indica que tanto PUM como BRAT se unen principalmente a las 3'UTR de sus transcripciones objetivo.

Los motivos PUM y BRAT se enriquecen principalmente en las 3'UTR de sus ARNm asociados. Los AUROC se calcularon para determinar la puntuación de enriquecimiento de los motivos PUM y BRAT determinados computacionalmente a partir de los datos de RIP-Chip en 5'UTR, ORF y 3'UTR de transcripciones objetivo. Evaluación del enriquecimiento de (A) el motivo BRAT entre todos los objetivos BRAT, (B) el motivo PUM entre todos los objetivos PUM, (C) el motivo BRAT entre el subconjunto de co-objetivos BRAT-PUM, y (D) el motivo PUM entre el subconjunto de co-objetivos BRAT-PUM.

Finalmente, para evaluar nuestra conclusión de que BRAT y PUM regulan principalmente diferentes conjuntos de transcripciones, evaluamos el enriquecimiento de los motivos de consenso entre los objetivos vinculados por BRAT y PUM juntos, solo PUM o solo BRAT. Encontramos que el motivo de consenso PUM está altamente enriquecido en los co-objetivos PUM y BRAT (AUROC = 0,84) así como en los objetivos solo PUM (AUROC = 0,82), pero está mucho menos enriquecido en los objetivos asociados solo con BRAT (AUROC = 0.60) (Figura 4A). De manera similar, el motivo BRAT de consenso se enriqueció mucho en los co-objetivos PUM y BRAT (AUROC = 0,84) así como en los objetivos solo BRAT (AUROC = 0,79), pero mucho menos fuertemente en los objetivos solo PUM (AUROC = 0,64) (Figura 4B). Estos resultados apoyan la conclusión de que, si bien BRAT y PUM se asocian conjuntamente con un subconjunto de transcripciones, se unen principalmente a diferentes conjuntos de ARNm.

Enriquecimiento de motivos PUM y BRAT entre ARNm asociados. (A) Gráficos AUROC que muestran qué tan bien el motivo PUM determinado a partir de nuestros datos de RIP-Chip distingue los siguientes conjuntos de los no objetivos coexpresados: co-objetivos BRAT y PUM, objetivos solo BRAT (objetivos BRAT no PUM) y objetivos solo PUM (Objetivos PUM, no BRAT). (B) Gráficos AUROC que muestran qué tan bien el motivo BRAT determinado a partir de nuestros datos de RIP-Chip distingue los siguientes conjuntos de los no objetivos coexpresados: co-objetivos BRAT y PUM, objetivos solo BRAT (objetivos BRAT no PUM) y objetivos solo PUM (Objetivos PUM, no BRAT). (C) Gráficos AUROC que muestran qué tan bien la presencia de un motivo BRAT solo (según lo determinado a partir de nuestros datos de RIP-Chip), un motivo PUM solo (según lo determinado a partir de nuestros datos de RIP-Chip), ya sea un motivo BRAT o PUM (cualquier motivo), o tanto un motivo BRAT como un motivo PUM (Ambos motivos), distinguen el conjunto de co-objetivos BRAT y PUM de los no-objetivos coexpresados.

Curiosamente, en este sentido, la pum El ARNm es alto en la lista de objetivos de PUM (veces de enriquecimiento = 20.5, FDR = 0%) y el palo de golf El ARNm es alto en la lista de objetivos BRAT (veces de enriquecimiento = 6.2, FDR = 0%) pero pum El ARNm no está en la lista de objetivos BRAT (veces de enriquecimiento = 1.1, FDR = NA) y palo de golf El ARNm no está en la lista de objetivos de PUM (veces de enriquecimiento = 1,04, FDR = 46%). Especulamos que PUM y BRAT autorregulan sus propios ARNm, pero no los de los demás.

In vitro identificación del espectro de sitios de unión BRAT

Para complementar el análisis computacional de búsqueda de motivos de los objetivos BRAT identificados por RIP-Chip, evaluamos el espectro de sitios que están vinculados por BRAT in vitro utilizando el ensayo RNAcompete [39,41]. Este ensayo implica la incubación de un RBP o RBD de interés etiquetado con GST con un exceso de un grupo complejo de aproximadamente 240.000 ARN de 30-41 mer que contiene al menos 16 copias de cada secuencia de 9 mer y al menos 310 copias de cada 7mer. Después de la captura de la proteína en la resina de glutatión, los ARN de co-purificación se identifican mediante micromatrices, lo que permite evaluar la especificidad de unión de la RBP.

Aplicando este enfoque al dominio BRAT NHL, que es el RBD de BRAT, identificamos un motivo que es muy similar al que definimos a través del hallazgo de motivo computacional aplicado a nuestros datos de RIP-Chip: este motivo RNAcompete tiene un consenso central UGUUA con un fuerte preferencia por un residuo de U antes y después del núcleo (Figura 2D y archivo adicional 6). Tomados junto con nuestro análisis computacional de ARNm asociados a BRAT, estos datos proporcionan una fuerte evidencia de que BRAT se une directamente al ARN, tanto in vitro y en vivo, a través de un motivo que lleva una secuencia UGUU central.

Los sitios de unión a BRAT dirigen la represión mediada por BRAT en células de cultivo de tejidos S2

Evaluar la importancia funcional del motivo de unión a BRAT predicho en vivo nosotros usamos Drosophila Células de cultivo de tejidos S2 en las que expresamos ARNm informadores de luciferasa que llevan una matriz de seis sitios de unión a BRAT de tipo salvaje o una matriz de seis puntos de unión a BRAT mutados en sus 3'UTR (Figura 5A). El informador con la matriz de tipo salvaje se reprimió 2,2 veces en relación con el informador con la matriz mutante (Figura 5B, Student's t prueba PAG & lt0.001). Para verificar que la represión observada fue, de hecho, mediada por BRAT, llevamos a cabo la eliminación de BRAT mediada por ARNi (archivo adicional 7). Sorprendentemente, la represión fue completamente abrogada tras la caída de BRAT (Figura 5C, Student's t prueba PAG & lt0.01). Concluimos que el motivo de unión a BRAT definido sobre la base de nuestro análisis computacional de transcripciones vinculadas a BRAT, así como in vitro utilizando RNAcompete, de hecho está vinculado por BRAT en vivo, y media en la represión de los objetivos atados.

BRAT reprime la expresión de transcripciones informadoras en células S2. (A) Esquema de los indicadores de luciferasa que contienen el ORF de luciferasa de luciérnaga fusionado a un 3'UTR que lleva seis sitios de unión BRAT de tipo salvaje (luc-wt) o seis mutados (luc-mut). (B) La actividad de luciferasa de cada uno de los indicadores se midió después de la transfección en células S2 y se normalizó a un control de luciferasa de Renilla. La actividad de la luciferasa se redujo a aproximadamente un 40% por los sitios de tipo salvaje en comparación con los sitios mutados. (C) La actividad de luciferasa normalizada (Firefly / Renilla) del luc-wt reporter en relación con el luc-mut reporter se midió tras el tratamiento con dsRNA de control o uno de los dos dsRNA dirigidos contra mocoso (archivo adicional 7 cuantifica la caída de BRAT). La caída mediada por ARN de mocoso anuló la represión del indicador luc-wt, lo que dio como resultado un aumento de aproximadamente tres veces en la expresión del indicador luc-wt en relación con el indicador mutado. (D) Los niveles de ARNm de luciferasa normalizados (Firefly / Renilla) del indicador luc-wt en relación con el indicador luc-mut se midieron mediante RT-qPCR tras el tratamiento con dsRNA de control o cualquiera de los dos dsRNA dirigidos contra mocoso. El nivel de estado estable del indicador luc-wt fue aproximadamente el 75% del del indicador mutado, lo que indica que los sitios de unión a BRAT reducen los niveles de ARN en estado estable. La caída de mocoso mediada por ARNi anuló esta represión, lo que dio como resultado un aumento de aproximadamente el doble en la expresión del informador de tipo salvaje en relación con el informador mutado. Comparando los resultados en (C) y (D), tanto la represión del informador de tipo salvaje en relación con el informador mutado como el aumento en la expresión del informador de tipo salvaje tras la caída de BRAT, fueron menores para los niveles de ARNm en estado estacionario (D) que para la actividad luciferasa (C), lo que indica que BRAT regula tanto la estabilidad del ARNm como la represión traduccional. Los valores representan el promedio de tres réplicas biológicas (B y C) o dos réplicas biológicas (D) y las barras de error indican la desviación estándar. Se indican los valores P de la prueba t de Student.

Los co-objetivos de PUM y BRAT contienen sitios de unión para ambos RBP

Si bien nuestros resultados indican que PUM y BRAT funcionan en gran medida por separado en la regulación del ARNm, hubo una superposición estadísticamente significativa entre sus conjuntos de transcripciones objetivo (prueba exacta de Fisher PAG value & lt10 −13 Figura 1C). Para este conjunto de co-objetivos, la co-ocurrencia de los motivos PUM y BRAT tuvo un valor predictivo similar (AUROC = 0,86) a la presencia de un motivo PUM o BRAT (AUROC = 0,90), y la presencia de cada uno motivo solo (motivo PUM AUROC = 0,84 y motivo BRAT AUROC = 0,84) (Figura 4C). Por lo tanto, los co-objetivos de PUM-BRAT tienen sitios de unión para ambas proteínas, lo que sugiere que están unidos directamente por ambas RBP y excluyen los modelos en los que PUM o BRAT se reclutan indirectamente para estos ARNm a través de una interacción con la otra proteína. Sin embargo, observamos que estos resultados no descartan la posibilidad de que PUM y BRAT cooperen en el reconocimiento de sus co-objetivos. En efecto, in vitro experimentos han demostrado que el PUM RBD mejora la afinidad del BRAT RBD por el media pensión NRE, y viceversa [17].

Análisis funcional de todos los ARNm asociados a PUM

Para obtener información sobre los procesos biológicos y moleculares regulados por PUM y BRAT, preguntamos si nuestros ARNm asociados a PUM y BRAT están enriquecidos para alguna función particular. Para evaluar esto, realizamos análisis de enriquecimiento de anotación de genes para nuestras listas de ARNm diana de PUM y BRAT utilizando la herramienta de anotación funcional DAVID [42, 43]. Para este análisis, los términos de anotación enriquecidos con un Benjamini PAG Se consideró significativo un valor de menos de 0,1 o un FDR de menos del 10%, como en nuestros análisis anteriores de los objetivos de Staufen (STAU) [33] y Smaug (SMG) [44].

El análisis de todo el conjunto de ARNm asociados a PUM reveló el enriquecimiento de una serie de funciones de desarrollo, celulares y moleculares (Tabla 1 Archivo adicional 8). Primero, los ARNm asociados a PUM estaban altamente enriquecidos para funciones relacionadas con la formación de patrones, el compromiso del destino celular y la morfogénesis durante la embriogénesis temprana. Por ejemplo, términos de Gene Ontology (GO) como 'especificación de patrón embrionario', 'especificación de eje', 'segmentación de blastodermo' y 'morfogénesis embrionaria' estaban altamente enriquecidos entre los ARNm asociados a PUM, de acuerdo con el análisis previamente informado de las transcripciones asociadas con PUM-RBD expresado transgénicamente [37]. Nuestros ARNm asociados a PUM que se incluían en estas categorías incluían aquellos con funciones conocidas en la formación del eje anterior-posterior y dorsal-ventral en ovocitos y embriones tempranos (por ejemplo, oskar (osk), nos, bicoide (bcd), caudal (canalla), pum sí mismo, gurken (grk), cactus (cactus), Pascua de Resurrección (ea), tragar (sudoeste), tolloid (tld)), así como los ARNm de genes gap, genes de reglas de pares y genes de polaridad de segmento y sus reguladores (por ejemplo, knirps (kni), Kruppel (Kr), jorobado (media pensión), caudal (canalla), descuidado emparejado 1 (slp1), incluso se saltó (víspera), cubitus interruptus (ci), encrespado 3 (fz3), hermano de tout-velu (botv)). Además, los objetivos de PUM incluían ARNm que codifican proteínas del grupo Polycomb y trithorax (por ejemplo, Polycomb (Ordenador personal), Peines sexuales posteriores (Psc), estéril femenino (1) homeótico (fs (1) h), Potenciador del bitórax (E (bx))), que regulan la transcripción de los genes homeóticos, así como reguladores de la actividad de los genes homeóticos (por ejemplo, homotórax (hth), teashirt (tsh)) y reguladores de la gastrulación (por ejemplo, gastrulación plegada (niebla)).

Tomados en conjunto, estos resultados sugieren que el papel de PUM en la formación de patrones y la morfogénesis durante la embriogénesis puede extenderse más allá de su papel bien caracterizado en el patrón posterior a través de la represión traslacional de derivados de la madre. media pensión ARNm. En apoyo de esta conclusión se informan defectos en el desarrollo anterior, incluidos defectos en la involución de la cabeza y la formación del gancho en la boca, que se han atribuido a la regulación de PUM de bicoide ARNm en la parte anterior del embrión [34]. De hecho, nuestro análisis de las cutículas de los embriones producidos por hembras portadoras de la combinación de alelos nulos, pum ET7 / pum Msc [45-47], mostró un patrón corporal severamente defectuoso, incluido el esqueleto de la cabeza reducido o ausente (96%) y la falta de los segmentos torácico y abdominal (100%) (n = 23). Con respecto a estos defectos observados, es interesante señalar que "segmentación de la cabeza" es uno de los términos GO relacionados con la formación de patrones enriquecidos entre nuestra lista de objetivos PUM e incluye los genes homotórax (hth), incluso se saltó (víspera), descuidado emparejado 1 (slp1), teashirt (tsh), fushi tarazu (ftz), media pensión, y jing.

Además de estos roles en la formación de patrones embrionarios, los ARNm asociados a PUM se enriquecieron para términos de GO relacionados con la formación de patrones y la morfogénesis durante una variedad de procesos de desarrollo que ocurren fuera de la ventana de tiempo analizada por nuestro RIP-Chip. Dichos términos GO enriquecidos incluían "ovogénesis", "formación de límites de órganos", "desarrollo del disco imaginario", "morfogénesis del tubo", "desarrollo de glándulas", "desarrollo de órganos sensoriales" y "compromiso con el destino de los neuroblastos". Como hemos discutido anteriormente para STAU [33], esto, en parte, refleja el hecho de que muchos de los genes y vías que están involucrados en los procesos embrionarios tempranos se reutilizan más tarde en el desarrollo (por ejemplo, 23 de 50 genes anotados con el término GO "desarrollo de disco imaginal" también se anota con términos GO relacionados con la formación de patrones embrionarios y la morfogénesis). Por lo tanto, especulamos que PUM puede tener funciones importantes en una variedad de etapas de desarrollo a través de la regulación de los mismos ARNm diana.

Los ARNm asociados a PUM también se enriquecieron para una serie de funciones a nivel celular. Estos incluían términos GO relacionados con el movimiento celular, como "movimiento celular" y "motilidad celular". De hecho, el PUM ha estado implicado en una variedad de procesos relacionados con la motilidad celular. Por ejemplo, PUM tiene un papel esencial en la migración de células germinales primordiales en embriones [23] y 35 de los 47 ARNm enumerados que codifican proteínas con funciones en la motilidad celular se expresan en células germinales primordiales. Seis de estos 35 han sido clasificados como enriquecidos en células germinales primordiales [48], incluyendo componente de gránulos polares (pgc), nos, y modificador de mdg4 (mod (mdg4)), todos los cuales también se han implicado específicamente en la migración de células germinales. La regulación de PUM de estas transcripciones también puede contribuir a su participación en procesos relacionados con la motilidad celular en otros tejidos. Por ejemplo, se ha demostrado que PUM regula la dendritogénesis en el sistema nervioso periférico de las larvas [49], y los términos GO "morfogénesis por proyección neuronal", "morfogénesis dendrítica" y "axonogénesis" se enriquecen entre los objetivos de PUM.

Los objetivos de PUM también se enriquecieron para los términos GO "división celular" y "división celular asimétrica". La regulación de PUM de estos ARNm puede contribuir al papel de PUM en la mitosis de células germinales primordiales, las divisiones de células madre de la línea germinal [50] y la regulación de las divisiones nucleares tempranas a lo largo del embrión temprano [35]. Además, los objetivos de PUM se enriquecieron en términos de GO relacionados con la regulación del tamaño celular y el crecimiento de organismos, así como con la apoptosis. Estos objetivos incluyen Receptor similar a la insulina (InR), Akt1, Pten, Objetivo de la rapamicina (Colina), y p53.

A nivel molecular, los ARNm diana de PUM codificaban proteínas que estaban altamente enriquecidas en términos de GO relacionados con la transducción de señales, como "transducción de señales ligada al receptor de la superficie celular" y "actividad de la proteína quinasa". El enriquecimiento de estas categorías es coherente con el análisis de las transcripciones asociadas con PUM-RBD expresado transgénicamente [37]. Nuestros ARNm asociados a PUM incluían componentes que codifican una variedad de vías de transducción de señales: Jak-STAT, Notch, Wnt, receptor de insulina y señalización de MAPK. Con respecto a la señalización de MAPK, se ha demostrado recientemente que PUM regula múltiples componentes de la vía de señalización de EGFR [51]. Nuestros datos pueden reflejar un papel bastante general para PUM en la regulación de la transducción de señales.

Los ARNm asociados a PUM también estaban altamente enriquecidos para funciones en la 'regulación de la transcripción', incluidas las que codifican activadores y represores transcripcionales que pertenecen a varias familias: proteínas HMG, proteínas homeobox, proteínas básicas hélice-bucle-hélice y familia Forkhead. proteínas. También es notable el ARNm que codifica Zelda / Vielfaltig (VFL), que se requiere para la activación de alto nivel de un subconjunto del genoma cigótico [52-54]. En conjunto, el papel de PUM en la regulación de la transducción y transcripción de señales puede reflejar los mecanismos mediante los cuales regula los procesos de desarrollo enumerados anteriormente.

Finalmente, los ARNm asociados a PUM se enriquecieron para términos de GO como "intrínseco a la membrana". Esto es, nuevamente, consistente con el análisis de ARNm asociados con PUM-RBD expresado transgénicamente [37]. Los productos de nuestros ARNm asociados a PUM se localizan en la membrana plasmática y en una variedad de membranas intracelulares y orgánulos.Particularmente enriquecidas estaban las glicoproteínas, glicosiltransferasas y proteínas relacionadas con la biosíntesis de proteoglicanos, lo que sugiere un papel de PUM en la regulación de la síntesis y función de las glicoproteínas.

Análisis funcional de todos los ARNm asociados a BRAT

A continuación, realizamos análisis de enriquecimiento por anotación de genes en todo el conjunto de ARNm asociados a BRAT (Tabla 1 Archivo adicional 8). Varios términos GO enriquecidos se superpusieron con los enriquecidos entre los ARNm unidos a PUM, incluida la "especificación del eje", la "cascada de señalización intracelular" y la "actividad de la proteína quinasa". El enriquecimiento de genes con funciones en la especificación del eje es consistente con el hecho de que los embriones producidos por palo de golf-las hembras mutantes tienen defectos en la segmentación abdominal [3], y sugiere que la mala regulación de los ARNm además de media pensión puede contribuir a este fenotipo.

Las dianas BRAT también se enriquecieron con ARNm que codifican proteínas de membrana, como lo indica el enriquecimiento de términos de GO como "intrínseco a la membrana", de nuevo similar a PUM. De hecho, este fue el término GO más enriquecido entre los ARNm asociados a BRAT, y sus proteínas codificadas se localizan tanto en la membrana plasmática (68 genes se anotaron con el término GO 'membrana plasmática') como en las membranas de una variedad de orgánulos (73 genes fueron anotados con el término GO 'membrana de orgánulos'), incluidos los del retículo endoplásmico, mitocondrias, Golgi, núcleo, lisosoma y peroxisoma. Una subclase particularmente enriquecida de estas proteínas, representada entre los ARNm asociados a BRAT pero no entre los ARNm asociados a PUM, está involucrada en el transporte de iones, incluidos los canales iónicos, los transportadores de iones dependientes de ATP y los factores de intercambio iónico.

Además de las proteínas de membrana en sí mismas, los ARNm diana de BRAT estaban altamente enriquecidos para las proteínas que codifican que regulan el componente lipídico de las membranas, como lo demuestra el enriquecimiento de términos GO como "proceso metabólico de fosfolípidos" y "proceso metabólico de fosfoinositidos". Estos incluyeron una serie de enzimas involucradas en la biosíntesis de ácidos grasos y la biosíntesis de fosfolípidos, así como enzimas involucradas en la adición de anclajes de glucofosfatidilinositol (GPI) a proteínas asociadas a la membrana. Además, incluían reguladores de la señalización de fosfoinositidos, tanto fosfatidilinositol quinasas como fosfatidilinositol fosfatasas.

Análisis funcional de ARNm asociados con PUM y BRAT

Dado que varios términos GO relacionados se enriquecieron entre los ARNm asociados a PUM y BRAT, a continuación preguntamos si alguna de estas funciones podría estar regulada específicamente por PUM y BRAT actuando juntos. Para abordar esto, realizamos análisis adicionales de enriquecimiento por anotación de genes en los conjuntos de ARNm que estaban asociados con: (1) solo PUM (2) solo BRAT y (3) tanto PUM como BRAT (Tabla 1 Archivo adicional 8). Esto reveló que la mayoría de los términos GO enriquecidos asociados con todos los objetivos PUM también se enriquecieron entre los objetivos solo PUM. De manera similar, la mayoría de los términos GO enriquecidos asociados con todos los objetivos BRAT también se enriquecieron cuando se consideraron los ARNm unidos solo por BRAT. Estos resultados sugieren que la mayoría de las funciones de PUM y BRAT pueden regularse independientemente unas de otras. Sin embargo, existen notables excepciones, que se analizan a continuación.

En primer lugar, los términos GO relacionados con la "diferenciación de neuroblastos" se enriquecieron significativamente entre el conjunto de co-objetivos BRAT-PUM. Estos términos GO no se enriquecieron entre las listas de solo PUM o solo BRAT. Se anotaron cinco co-objetivos BRAT-PUM con este término, incluidos tres de los cuatro factores de transcripción que componen el complejo achaete-scute (achaete (C.A), escudo (Carolina del Sur), y letal de escudo (l (1) sc)), que tienen un papel importante en la especificación del destino de los neuroblastos, así como media pensión y jumeau (jumu). Aunque nuestros RIP se realizaron en etapas embrionarias antes de la formación de neuroblastos, esto es particularmente interesante dada la función bien caracterizada de BRAT en la regulación de la diferenciación de neuroblastos. Tomados en conjunto, estos datos sugieren un papel cooperativo para PUM y BRAT en la diferenciación de neuroblastos a través de la regulación de las transcripciones mencionadas anteriormente.

En segundo lugar, los términos GO "especificación del eje", "determinación cigótica del eje anterior / posterior, embrión" y "transducción de señales" se enriquecieron entre los co-objetivos BRAT-PUM. Varios términos similares o idénticos se enriquecieron entre los objetivos exclusivos de PUM, pero no entre los objetivos exclusivos de BRAT. Esto es consistente con la posibilidad de que estas funciones sean reguladas por BRAT y PUM de manera cooperativa.

Análisis de la localización de ARNm asociados a PUM y BRAT

A continuación, analizamos los patrones de localización de las diferentes clases de transcripciones de destino para definir los aspectos espaciales de la función PUM y BRAT. Para ello utilizamos las anotaciones de patrones de localización en la base de datos Fly-FISH [55,56]. Los términos de anotación y los patrones de localización enriquecidos con un FDR de menos del 10% se consideraron significativos, como en nuestros análisis anteriores de los objetivos de STAU [33] y SMG [44].

Los ARNm asociados a PUM se enriquecieron para una variedad de patrones de localización (Tabla 2 Archivo adicional 9). Por ejemplo, las dianas de PUM estaban altamente enriquecidas para las transcripciones localizadas en la 'posterior' y en el 'plasma polar' durante las etapas embrionarias 1 a 3. Esto es consistente con el requisito de PUM para la migración y mitosis de células germinales primordiales normales, procesos que PUM puede controlar a través de la regulación postranscripcional de estos ARNm localizados en la parte posterior. Los objetivos de PUM también se enriquecieron para ARNm con patrones de localización "perinuclear" (en las etapas 1 a 3) y "aparato de división celular" (en las etapas 4 a 5). Estos enriquecimientos pueden reflejar el papel de PUM en la división celular en una variedad de contextos, como se discutió anteriormente. Los ARNm asociados a BRAT, como los ARNm asociados a PUM, se enriquecieron significativamente en genes con patrones de localización "posterior", así como en localización "perinuclear" (Tabla 2 Archivo adicional 9).

De acuerdo con el papel de PUM en la regulación de la formación de patrones a través del control de ARNm transcritos zigóticamente, los objetivos de PUM también se enriquecieron significativamente tanto para las transcripciones transcritas zigóticamente, en general, como para los patrones de localización del "gen gap", en particular. Además, los ARNm asociados a PUM se enriquecieron para patrones de localización "apical".

A continuación, evaluamos si los enriquecimientos observados también se aplicaban a los ARNm co-diana PUM-only, BRAT-only y / o PUM-BRAT (Tabla 2 Archivo adicional 9). Los patrones de localización 'apical', 'aparato de división celular' y 'genes gap', así como las transcripciones 'transcritas zigóticamente' en general, se mantuvieron significativamente enriquecidas entre las transcripciones solo de PUM, pero no entre los co-objetivos de solo BRAT o PUM-BRAT . Sin embargo, "perinuclear" y "localización posterior" se enriquecieron entre los co-objetivos PUM y BRAT, pero no entre los objetivos solo PUM o BRAT solo. Este enriquecimiento para la localización posterior sugiere que BRAT puede contribuir a algunas de las funciones de PUM en el desarrollo de células polares.

Dado que tanto PUM como BRAT son ubicuos, mientras que NOS se localiza posteriormente, especulamos que NOS proporciona especificidad espacial a las transcripciones co-reguladas, como es el caso de media pensión ARNm. En apoyo de esta idea, se ha demostrado que una mutación en NOS afecta el reclutamiento de BRAT al segundo media pensión NRE in vitro y represión traslacional de hb in vivo, sin afectar la asociación de NOS o PUM con NRE [3], lo que sugiere que NOS puede estabilizar la interacción de BRAT con los co-objetivos de PUM-BRAT.

Los ARNm asociados a BRAT y PUM se reprimen y degradan traslacionalmente durante la transición de la madre al cigótico.

Para obtener más información sobre cómo funcionan PUM y BRAT para regular sus transcripciones diana, aprovechamos los conjuntos de datos de todo el genoma publicados anteriormente que definían el estado de traducción o la estabilidad de los ARNm a principios de Drosophila embriones. Primero evaluamos la eficiencia con la que los ARNm diana de PUM y BRAT se traducen en embriones tempranos. Para hacer esto, hicimos uso de nuestros datos publicados que emplearon gradientes de polisomas seguidos de análisis de microarrays para definir, en todo el genoma, la eficiencia con la que los ARNm se traducen en embriones de tipo salvaje de 0 a 2 horas de edad (Chen et al., [44]). Esto se logró calculando el 'índice de traducción' para cada ARNm dividiendo la cantidad de ese ARNm que está asociado a polisomas y, por lo tanto, es probable que se traduzca, por la cantidad que no está asociada a polisomas y, por lo tanto, no se traduce [44 ]. Encontramos que los índices de traducción de los ARNm diana de PUM y BRAT eran significativamente más bajos que los índices de traducción de todas las transcripciones analizadas en nuestros experimentos de RIP (Figura 6A, Tabla 3). Esto es consistente con las funciones conocidas de PUM y BRAT como represores de la traducción. Para evaluar más a fondo esta conclusión, también comparamos nuestros ARNm objetivo con listas de ARNm definidos como 'traduccionalmente activos' o 'traduccionalmente inactivos' en embriones de 0 a 2 horas de edad mediante un segundo microarray de gradiente de polisoma independiente de todo el genoma. estudiar (Qin et al., [57]). Una vez más, de acuerdo con su función como represor, los ARNm asociados a BRAT se superpusieron significativamente con la lista de transcripciones traduccionalmente inactivas y se redujeron significativamente de transcripciones translacionalmente activas (Tabla 3 Archivo adicional 10). Los objetivos de PUM no se correlacionaron significativamente con la represión traslacional según esta comparación (Tabla 3 Archivo adicional 10).

Los ARNm asociados a BRAT y PUM se reprimen traduccionalmente y los ARNm asociados a BRAT se degradan durante la MZT. (A) Diagramas de caja que representan los índices de traducción de embriones de 0 a 2 h de tipo salvaje [44] para todas las transcripciones expresadas (es decir, todas las transcripciones que se encuentran expresadas en nuestros embriones de 0 a 3 h utilizados para los experimentos de RIP-Chip), BRAT no transcripciones objetivo, transcripciones no objetivo PUM, todas las transcripciones objetivo BRAT, transcripciones objetivo BRAT-no-PUM (es decir, todos los objetivos BRAT excluyendo co-objetivos BRAT-PUM), todas las transcripciones objetivo PUM, transcripciones objetivo PUM-no-BRAT ( es decir, todos los objetivos de PUM, excepto los co-objetivos de BRAT-PUM) y las transcripciones de los co-objetivos de BRAT y PUM. Un índice de traducción más alto indica ARNm traducidos más activamente. La línea de puntos representa el índice de traducción medio de todas las transcripciones expresadas detectadas en nuestro lisado embrionario de entrada RIP de 0 a 3 h. (B) Diagramas de caja que representan la proporción de ARN presente en embriones de 2 a 4 h en comparación con embriones de 0 a 2 horas, de acuerdo con los datos de modENCODE RNAseq disponibles en FlyBase, para los mismos conjuntos de transcripciones descritos en (A). Tenga en cuenta que los valores atípicos (es decir, las transcripciones cuyo valor es superior a 1,5 veces la distancia intercuartil superior o inferior a los cuartiles superior o inferior, respectivamente) no se muestran para permitir que el eje y se amplíe alrededor de los valores de la mediana. La línea de puntos representa la mediana de todas las transcripciones expresadas detectadas en nuestro lisado de embriones de entrada RIP de 0 a 3 h. Para ambos (A) y (B) Se realizaron pruebas de suma de rangos de Wilcoxon para determinar la importancia de las diferencias entre los objetivos BRAT y PUM en comparación con "Todas las transcripciones expresadas": *PAG & lt0.01, **PAG & lt10 −5, ***PAG & lt10 −27.

Los subconjuntos de transcripciones vinculadas solo por BRAT o solo por PUM tenían índices de traducción significativamente más bajos según lo definido por Chen et al. [44] que el conjunto de todas las transcripciones expresadas (Figura 6A Tabla 3). Las transcripciones asociadas solo con BRAT se superpusieron significativamente con Qin et al.[57] transcripciones traduccionalmente inactivas y se agotaron las transcripciones traduccionalmente activas (Tabla 3 Archivo adicional 10). Estos resultados sugieren que BRAT y PUM son capaces de mediar en la represión traslacional de forma independiente entre sí. Como era de esperar, los co-objetivos BRAT y PUM también se correlacionaron significativamente con la represión traslacional en comparación con ambos conjuntos de datos [44, 57] (Figura 6A Tabla 3 Archivo adicional 10).

A continuación, preguntamos si podíamos detectar alguna relación entre la unión de PUM o BRAT y la estabilidad del ARNm durante la MZT en embriones tempranos. Para este análisis, utilizamos varios conjuntos de datos publicados anteriormente: de De Renzis et al. [58] y Thomsen et al. [59], que definió el conjunto completo de transcripciones maternas que se degradan durante el MZT de Fly-FISH [55,56], que anota las transcripciones que se degradan en etapas específicas de desarrollo de modENCODE RNAseq, que midió los niveles de transcripción en embriones en varios etapas de desarrollo, incluidos los embriones recolectados de 0 a 2 h versus 2 a 4 h después de la puesta de huevos y de Thomsen et al. [59] y Tadros et al. [60], que definió si las transcripciones que se degradan durante el MZT se eliminan mediante mecanismos de desintegración codificados materna ("temprano") y / o codificados zigóticamente ("tardío").

Nuestra lista de ARNm asociados a PUM se enriqueció significativamente para ARNm maternos inestables según lo definido por Thomsen et al. [59] (Cuadro 3 Archivo adicional 10). Además, los ARNm asociados a PUM se enriquecieron significativamente para las transcripciones anotadas como "Degradado completamente en etapa 5" en la base de datos Fly-FISH (Tabla 3 Archivo adicional 9). Nuestras transcripciones asociadas a PUM no se enriquecieron para las eliminadas por la maquinaria de descomposición temprana, como se define en [59,60] (Tabla 3 Archivo adicional 10). Por el contrario, nuestros conjuntos de ARNm asociados a PUM, de dianas solo de PUM y de co-dianas de PUM-BRAT se enriquecieron significativamente para las transcripciones degradadas por la maquinaria de desintegración tardía (como se define en [59]). Además, las transcripciones de solo PUM se enriquecieron significativamente para las anotadas como "Degradado completamente en etapa 5" en la base de datos Fly-FISH (Tabla 3 Archivos adicionales 9 y 10). Estos resultados son consistentes con Thomsen et al.El análisis de ARNm asociados con PUM-RBD expresado transgénicamente [37], lo que les llevó a concluir que las transcripciones unidas a PUM-RBD experimentan una desintegración tardía. Tomados en conjunto, nuestros datos son consistentes con la hipótesis de que PUM juega un papel en la degradación del ARNm tarde durante el MZT [58, 59].

Si bien se había predicho previamente que PUM estaría involucrado en la desintegración del ARNm [59], hasta ahora no ha habido evidencia de un papel de BRAT en la desestabilización del ARNm. Sorprendentemente, sin embargo, los ARNm asociados a BRAT estaban muy enriquecidos para las transcripciones maternas que se degradan durante el MZT como se define en De Renzis. et al. [58] y Thomsen et al. [59] (Cuadro 3 Archivo adicional 10), así como las transcripciones degradadas durante las etapas 4 a 5 según lo definido por la base de datos Fly-FISH (Cuadro 3 Archivo adicional 9). Además, el análisis de los datos de modENCODE RNAseq reveló que, para los objetivos BRAT, la cantidad de ARN presente en embriones de 2 a 4 h frente a embriones de 0 a 2 h es significativamente menor que para el conjunto completo de genes analizados en nuestro conjunto de datos RIP-Chip ( Figura 6B Tabla 3). A diferencia de PUM, los objetivos BRAT se enriquecieron en ARNm degradados tanto por la maquinaria de desintegración temprana como se define en ambos Thomsen et al. [59] y Tadros et al. [60] y la maquinaria de descomposición tardía [59] (Cuadro 3 Archivo adicional 10). En particular, todos estos enriquecimientos también fueron ciertos para el subconjunto de ARNm solo BRAT (Figura 6B Tabla 3 Archivos adicionales 9 y 10).

Tomados en conjunto, estos datos sugieren fuertemente que, además de su papel como represor de traducción, BRAT tiene una importante función independiente de PUM en la desestabilización del ARNm durante la MZT, actuando como un componente de las maquinarias de desintegración temprana y tardía. Un apoyo adicional al papel de BRAT en la descomposición es el enriquecimiento previamente informado de un motivo UUGUU entre mRNA maternos inestables [58], que lleva el núcleo UGUU de nuestro motivo de consenso BRAT. Combinado con el fuerte enriquecimiento de las transcripciones inestables entre nuestros ARNm asociados a BRAT, estos resultados conducen a la predicción de que BRAT es un regulador de la degradación de la transcripción durante la MZT.

BRAT reduce la traducción y la estabilidad del ARNm en células de cultivo de tejidos S2

Como primer paso hacia la evaluación del posible papel de BRAT en la descomposición del ARNm, utilizamos el ensayo indicador de luciferasa de células de cultivo de tejidos S2 descrito anteriormente (Figura 5A). RT-qPCR mostró que el nivel de estado estable de las transcripciones que llevan la matriz de seis sitios de unión a BRAT de tipo salvaje era menor que el de las transcripciones que llevaban la matriz de seis sitios de unión a BRAT con mutaciones puntuales (Figura 5D, Control RNAi), coherente con el papel de BRAT en la promoción de la degradación del ARNm. Este efecto sobre el ARNm informador que lleva los sitios de unión a BRAT de tipo salvaje fue mediado por BRAT, ya que los niveles de transcripción del indicador aumentaron más del doble tras la caída de BRAT mediada por ARN (Figura 5D, palo de golf ARNi 1 y 2). La comparación de los datos en las Figuras 5C y D sugiere que BRAT también reprime traduccionalmente sus dianas ya que, tras la caída de BRAT, hubo un mayor aumento en la actividad de la enzima luciferasa (aproximadamente tres veces) que en los niveles de ARNm de luciferasa (aproximadamente dos veces). Estos resultados son consistentes con el papel de BRAT tanto en la represión traslacional como en la inducción de la degradación de sus objetivos.

Los ARNm asociados a BRAT se estabilizan en embriones de palo de golf-hembras mutantes

A la luz de la nueva función predicha de BRAT en la desintegración del ARNm durante el MZT, a continuación usamos microarrays para comparar globalmente el transcriptoma de 0 a 1,5, de 1,5 a 3, de 3 a 4,5 y de 4,5 a 6 h -embriones viejos de palo de golf-hembras mutantes (referidas en adelante como "palo de golf embriones mutantes ') a embriones de tipo salvaje en las mismas etapas. Esto resultó en la identificación de 1,182 genes cuyos niveles de transcripción eran significativamente más altos y 1,022 genes cuyos niveles de transcripción eran significativamente más bajos en palo de golf mutantes de tipo salvaje en uno o más puntos de tiempo (FDR & lt5% Figura 7A a D Archivo adicional 11).

Los ARNm asociados a BRAT están regulados al alza globalmente en palo de golf-Embriones mutantes. Diagramas de dispersión de la intensidad de la señal normalizada por RMA en palo de golf mutante versus w 1118 embriones en (A) 0 a 1,5 h, (B) 1,5 a 3,0 h, (C) 3,0 a 4,5 h, y (D) 4.5 a 6.0 h después de la puesta. Los gráficos muestran todas las transcripciones representadas en la micromatriz que se definieron como expresadas (consulte Métodos). Los valores representan promedios de tres réplicas biológicas independientes. La línea diagonal continua no representa ningún enriquecimiento. Transcripciones hacia arriba o hacia abajo en palo de golf Los embriones mutantes en comparación con los embriones de tipo salvaje con un FDR & lt5% se definieron como transcripciones reguladas hacia arriba o hacia abajo, y están resaltadas con naranja y magenta, respectivamente. Al lado de cada gráfico hay diagramas de Venn que representan la superposición entre las transcripciones reguladas al alza en el punto de tiempo correspondiente y el conjunto de ARNm asociados a BRAT definidos por nuestro RIP-Chip (ver también la Tabla 4).Tenga en cuenta que estas comparaciones sugieren que las transcripciones reguladas al alza en 1,5 a 3,0, 3,0 a 4,5 y 4,5 a 6,0 h están directamente reguladas por BRAT ya que están enriquecidas por ARNm asociados a BRAT. En contraste, aquellos regulados al alza de 0 a 1,5 h probablemente reflejen cambios resultantes de los efectos secundarios de la palo de golf mutación. El número total de transcripciones asociadas a BRAT (890) que se muestran en esta figura y la Figura 8 difiere del número de la Figura 1 (1.197) debido a diferencias en el conjunto de genes expresados ​​definidos para estos dos experimentos. Solo consideramos el subconjunto de objetivos BRAT identificados en la Figura 1 que también se definieron como se expresa en el palo de golf-Se muestra el curso temporal mutante aquí. Asimismo, en los diagramas de Venn de esta figura y en la Figura 8, el número de transcripciones reguladas al alza en palo de golf los mutantes difieren de los números en los gráficos asociados. **PAG & lt10 −11 (prueba exacta de Fisher con corrección de Bonferroni).

Si BRAT tiene un papel en la desintegración del ARNm, uno esperaría que los genes que están regulados positivamente en palo de golf los embriones mutantes serían objetivos directos de BRAT. De hecho, hubo una superposición muy significativa entre los ARNm asociados a BRAT según lo definido por nuestro experimento RIP-Chip y las transcripciones reguladas al alza en palo de golf embriones mutantes en 1,5 a 3,0, 3,0 a 4,5 y 4,5 a 6,0 h (Figura 7B a D, Tabla 4, prueba exacta de Fisher con corrección de Bonferroni PAG los valores oscilaron entre 6,6 × 10 −12 y 5,7 × 10 −20). Además, las 3'UTR de las transcripciones reguladas positivamente se enriquecieron significativamente para los sitios de unión a BRAT en relación con las transcripciones coexpresadas cuyo nivel de expresión no se modificó en palo de golf-embriones mutantes (Tabla 4, los valores de AUROC variaron de 0,56 a 0,59 Suma de rango de WMW corregida por Bonferroni PAG los valores oscilaron entre 0,016 y 6,1 × 10 −6 Archivo adicional 12). Tomados en conjunto, estos datos sugieren fuertemente que la regulación positiva de las transcripciones en 1,5 a 3,0, 3,0 a 4,5 y 4,5 a 6,0 h es una consecuencia directa de la ausencia de unión BRAT.

Por el contrario, en el punto de tiempo de 0 a 1,5 h, no hubo una superposición significativa entre los ARNm asociados a BRAT y los regulados positivamente en palo de golf embriones mutantes (Figura 7A, Tabla 4, prueba exacta de Fisher con corrección de Bonferroni PAG = 1) y las 3'UTR de estas transcripciones no se enriquecieron para los sitios de unión a BRAT (AUROC = 0.52 Suma de rango WMW corregida por Bonferroni PAG = 1 Tabla 4 Archivo adicional 12), lo que sugiere que la regulación al alza de estas transcripciones en el primer momento no es un resultado directo de la vinculación BRAT y puede, en cambio, deberse a efectos secundarios asociados con la palo de golf fenotipo mutante. Nuestro análisis de las transcripciones que fueron reguladas a la baja en palo de golf Los embriones mutantes también sugirieron que no son objetivos BRAT directos (Tabla 4, archivo adicional 12).

BRAT promueve la degradación de los ARNm maternos a través de las maquinarias de desintegración temprana y tardía

Habiendo demostrado que los ARNm asociados a BRAT están regulados positivamente en palo de golf embriones mutantes, a continuación, evaluamos la dinámica de expresión de los genes regulados al alza mediante la agrupación de k-medias [61, 62]. Este método subdividió las transcripciones reguladas positivamente en seis clases distintas basadas únicamente en su expresión en embriones de tipo salvaje (Figura 8, Archivos adicionales 13 y 14). Estas seis clases se pueden dividir libremente en dos subconjuntos. El primer subconjunto incluye las clases A, B y C, que consisten en transcripciones que comienzan en niveles relativamente altos en el punto de tiempo de 0 a 1,5 horas y se degradan posteriormente (Figura 8A a C Archivo adicional 14), lo que sugiere que estos las clases comprenden en gran parte transcripciones expresadas por la madre que se degradan durante el MZT. De hecho, la comparación de las transcripciones de las clases A, B y C con los conjuntos de datos publicados anteriormente [58-60] reveló que prácticamente todos están depositados por vía materna y que las clases B y C están significativamente agotadas de ARNm transcritos de forma zigótica, mientras que la clase A parece representar a la madre. ARNm expresados ​​que se degradan y luego se reexpresan tras la activación del genoma cigótico (Tabla 5 Archivo adicional 15). El segundo subconjunto incluye las clases D, E y F, que consisten en transcripciones que aumentan en abundancia entre los puntos de tiempo de 0 a 1,5 hy de 1,5 a 3,0 h (Figura 8D a F Archivo adicional 14), lo que sugiere que comprenden principalmente transcripciones que se expresan tras la activación del genoma cigótico. De acuerdo con esto, están altamente enriquecidos para transcripciones expresadas zigóticamente, y las Clases D y E están significativamente reducidas de transcripciones expresadas maternalmente (Tabla 5 Archivo adicional 15).

BRAT promueve la descomposición de los ARNm expresados ​​por la madre durante la MZT a través de las maquinarias de descomposición temprana y tardía. Análisis de agrupamiento de K-medias de la unión de transcripciones reguladas al alza en cualquier momento en palo de golf los embriones mutantes dividieron las transcripciones en seis clases sobre la base de su expresión en embriones de tipo salvaje. (A-F) Gráficos que muestran los niveles de expresión promedio (intensidad de señal normalizada por RMA) de las transcripciones en cada clase, en tipo salvaje (línea continua) y palo de golf embriones mutantes (línea discontinua), de 0 a 6 h después de la puesta de huevos. Debajo de cada gráfico hay diagramas de Venn que representan la superposición de las transcripciones en cada clase con el conjunto de ARNm asociados a BRAT definidos por nuestro RIP-Chip. Estas comparaciones indican que las clases A, B y C están significativamente enriquecidas en ARNm asociados a BRAT y, por lo tanto, es probable que sean dianas directas de BRAT. Por el contrario, las clases D, E y F no muestran ningún enriquecimiento para los ARNm asociados a BRAT y, por lo tanto, es probable que estén reguladas al alza como resultado de los efectos secundarios de los ARNm asociados a BRAT. palo de golf mutación. Dado que las Clases A, B y C comprenden transcripciones expresadas por la madre que sufren descomposición durante el MZT, a través de las maquinarias tempranas (Clases A y B) y tardías (Clase C) (ver texto y Tabla 5), ​​su estabilización en palo de golf mutantes indica un papel para BRAT en la desintegración de los ARNm maternos durante la MZT a través de las maquinarias de desintegración temprana y tardía. *PAG & lt10 −6, **PAG & lt10 −18 (prueba exacta de Fisher).

Para comprender la naturaleza del papel potencial de BRAT en su regulación, evaluamos el enriquecimiento de ARNm asociados a BRAT (según lo definido por nuestro experimento RIP-Chip) en cada clase de expresión. Sorprendentemente, esto reveló que cada una de las Clases A, B y C se enriquecieron significativamente en ARNm asociados a BRAT, lo que sugiere que estos ARNm son objetivos directos de BRAT (Tabla 5 Archivo adicional 15). Por el contrario, las clases D, E y F no se enriquecieron con ARNm asociados a BRAT, lo que sugiere que es probable que su regulación al alza sea el resultado de efectos indirectos de la palo de golf fenotipo mutante (Tabla 5 Archivo adicional 15). La segregación de ARNm asociados a BRAT en las Clases A a C es especialmente impresionante cuando se considera que las seis clases se generaron mediante el análisis de la expresión de estas transcripciones solo en embriones de tipo salvaje. Juntos, estos datos apoyan firmemente un papel importante para BRAT en la regulación directa de la desestabilización de sus ARNm maternos diana durante el MZT.

Un examen más detenido de los patrones de expresión de las transcripciones presentes en las clases A a C sugiere que BRAT funciona tanto en las vías de desintegración temprana como tardía, como había predicho nuestro análisis anterior de los ARNm asociados a BRAT. En los embriones de tipo salvaje, las transcripciones de Clase C se mantuvieron estables durante los dos primeros puntos de tiempo, pero se degradaron en el punto de tiempo de 3,0 a 4,5 h, lo que indica una descomposición a través de una vía tardía. Por el contrario, los ARNm de Clase A y B disminuyeron entre los puntos de tiempo de 0 a 1,5 hy de 1,5 a 3,0 h, lo que sugiere una desintegración a través de una vía temprana. No está claro si los ARNm de clase A y B también se degradan a través de vías tardías. La tasa de disminución de los ARNm en la Clase B fue constante entre los puntos de tiempo de 0 a 1,5 hy de 3,0 a 4,5 h, lo que sugiere que no son también atacados por una maquinaria de acción tardía; sin embargo, sigue siendo posible que una maquinaria materna que actúe en estos ARNm se reemplaza por uno que actúa zigóticamente. La expresión de los ARNm de clase A aumentó en el tipo salvaje en el punto de tiempo de 3.0 a 4.5 horas, lo que indica que estos genes también se transcriben de forma zigótica, lo que nos impidió determinar si los ARNm de clase A también están sujetos a degradación a través de una vía tardía. Observamos que las transcripciones de Clase A se superponen significativamente con las previamente definidas [59] como degradadas a través de las vías 'materna solamente' y 'materna más cigótica' Transcripciones de Clase B con las vías 'materna más cigótica' y 'solo cigótica' y las transcripciones de Clase C con ' vías cigóticas solamente '(Tabla 5). Estas superposiciones son consistentes con nuestra evaluación de los patrones de expresión de estas diferentes clases, y apoyan la conclusión de que BRAT promueve la degradación del ARNm a través de vías de desintegración temprana y tardía.

Maternalmente cargado media pensión El ARNm se estabiliza en embriones que carecen de proteína BRAT funcional

Antes de nuestros análisis de todo el transcriptoma que se informan aquí, el media pensión El ARNm era el único objetivo directo conocido de BRAT, que se demostró que reprime una luciferasa-hb 3UTR reportero de ARNm en células S2 [17]. Nuestros experimentos con RIP-Chip han demostrado que media pensión El ARNm se co-purifica con BRAT en embriones tempranos. Por lo tanto, fue de particular interés preguntar si se requiere BRAT para la degradación de la madre. media pensión transcripciones, además del papel bien establecido de BRAT en la represión traslacional de media pensión ARNm. Ya que media pensión las transcripciones se cargan maternalmente (el hb-RB isoforma de ARNm), así como sintetizado zigóticamente (el hb-RA isoforma de ARNm), y las sondas en nuestro microarray no distinguieron entre estas isoformas, llevamos a cabo RT-qPCR con maternal-media pensión-específico (hb-RB) cebadores para evaluar si se estabilizó en embriones producidos por palo de golf-Hembras mutantes. De acuerdo con el papel de BRAT en la desestabilización de las transcripciones maternas, hb-RB estuvo presente en niveles significativamente elevados en palo de golf mutante en comparación con los embriones de tipo salvaje, particularmente en los puntos de tiempo de 1,5 a 3 hy de 3 a 4,5 h (Figura 9). Concluimos que BRAT media tanto la represión traslacional como la degradación de la media pensión ARNm.

Expresado maternalmente media pensión El ARNm se estabiliza en palo de golf-Embriones mutantes. Niveles de la isoforma de expresión materna de media pensión ARNm (media pensión-RB) fueron analizados por RT-qPCR en palo de golf embriones mutantes o de tipo salvaje recolectados 0 a 1.5, 1.5 a 3.0, 3.0 a 4.5 y 4.5 a 6.0 h después de la puesta de huevos, y normalizados a niveles de RpL32 ARNm, cuyos niveles son estables a lo largo de este transcurso de tiempo. media pensión Los niveles de ARNm fueron significativamente más altos en palo de golf embriones mutantes que de tipo salvaje a las 1,5 a 3,0, 3,0 a 4,5 y 4,5 a 6,0 h (los valores representan el promedio de tres réplicas biológicas +/- error estándar de la media). *PAG & lt0.05, **PAG & lt0.005 (prueba t de Student).

Análisis de las funciones y patrones de localización de ARNm estabilizados en palo de golf mutantes

Luego preguntamos si alguna función anotada particular o patrón de localización se enriqueció entre las clases de transcripción A, B y C. Sorprendentemente, los términos GO enriquecidos en estas tres clases eran casi idénticos a los enriquecidos entre el conjunto completo de ARNm asociados a BRAT e incluían 'intrínseco a la membrana', 'transporte de iones', 'proceso metabólico del fosfato', 'señalización Jak-STAT', 'especificación del patrón embrionario' y términos relacionados con el metabolismo de lípidos y glicerofosfolípidos (Tabla 6 Archivo adicional 16). Sin embargo, una pequeña cantidad de términos GO se enriquecieron entre las transcripciones estabilizadas, pero no entre el conjunto de ARNm asociados a BRAT (por ejemplo, "metabolismo del almidón y la sacarosa"). Los patrones de localización enriquecidos entre los ARNm estabilizados incluyeron la localización de células polares y posteriores, así como la localización perinuclear, de nuevo en consonancia con los que habíamos encontrado enriquecidos entre los ARNm asociados a BRAT (Tabla 7 Archivo adicional 17).

El hecho de que las funciones anotadas y los patrones de localización enriquecidos entre las clases A, B y C coincidieran tan estrechamente con los enriquecidos entre el conjunto de ARNm asociados a BRAT respalda aún más nuestra conclusión de que estas tres clases de transcripciones representan en gran medida objetivos directos de BRAT.

La expresión de los genes diana de Zelda (Vielfaltig) está mal regulada en los primeros momentos de palo de golf embriones mutantes

Como se describió anteriormente, las Clases D a F comprenden en gran medida transcripciones expresadas de forma zigótica que están reguladas al alza en palo de golf mutantes de una manera que no depende directamente de BRAT. Esto nos llevó a preguntarnos si la misexpresión de alguno de los ARNm de factores de transcripción unidos por BRAT podría explicar su regulación positiva. El ARNm que codifica Zelda (VFL), que es esencial para la activación del genoma cigótico normal [52-54], se asoció fuertemente con BRAT en nuestros experimentos de RIP-Chip (enriquecido 5,1 veces, FDR = 0%). Por lo tanto, preguntamos si alguna de las transcripciones reguladas al alza en las clases D, E y F corresponde a genes previamente definidos como objetivos de Zelda (VFL). Sorprendentemente, las tres clases se enriquecieron significativamente para las transcripciones codificadas por genes cuyos promotores se ha demostrado que se unen directamente a Zelda (VFL) según lo analizado a través de ChIP-Seq [52] (Tabla 5 Archivo adicional 15). Hubo un enriquecimiento similar entre las Clases D y F, pero no la Clase E, para las transcripciones que anteriormente se demostró que estaban reguladas a la baja en zelda (vfl) embriones mutantes [53] (Cuadro 5 Archivo adicional 15).

En palo de golf-Las transcripciones de embriones mutantes en las clases D, E y F se regulan positivamente en el punto de tiempo de 0 a 1,5 h, que se superpone con la fase en la que se sabe que Zelda / VFL se une a sus genes diana y activa su transcripción [52-54] . Por lo tanto, planteamos la hipótesis de que, en los embriones de tipo salvaje, el BRAT RBP reprime la zelda (vfl) ARNm. En palo de golf embriones mutantes, entonces, Zelda (VFL) se regularía positivamente, lo que conduciría a la regulación positiva de sus genes diana (por ejemplo, media pensión [54] El archivo adicional 18 muestra el efecto sobre la transcripción zigótica media pensión en palo de golf mutantes). De acuerdo con este modelo está el hecho de que el aumento del número de sitios de unión de Zelda (VFL) en un gen diana de Zelda (VFL) da como resultado una transcripción más temprana de ese gen [63,64]. Además, mientras que el zelda (vfl) el ARNm está unido por BRAT, no detectamos un cambio en zelda (vfl) niveles de ARNm en palo de golf embriones mutantes. Por lo tanto, es probable que BRAT regule la zelda (vfl) ARNm a nivel de traducción. Sin embargo, con respecto a la regulación positiva de los genes diana de Zelda, no podemos excluir la posibilidad de que BRAT también regule la estabilidad o la traducción de los ARNm que codifican cofactores de Zelda.

El papel de otros trans-factores que actúan en la desintegración del ARNm dependiente de BRAT

El SMG se ha identificado previamente como un importante regulador de la eliminación del ARNm materno a través de una vía de desintegración temprana codificada por la madre en el embrión [60] mientras que el miR-309 Se ha demostrado que el grupo de miARN, que se expresa zigóticamente, actúa a través de una vía tardía [65,66]. Comparaciones de los ARNm de las clases A, B y C con los ARNm que requieren SMG o el miR-309 El clúster para su degradación no mostró una superposición significativa (Tabla 5 Archivo adicional 15), lo que sugiere que BRAT no coopera con SMG o el miR-309 miARN en la degradación de la transcripción. Por lo tanto, la degradación del ARNm mediada por BRAT puede representar una vía nueva para la desintegración de la transcripción temprana y tardía durante la MZT. Se ha encontrado previamente que BRAT co-inmunoprecipita con la subunidad NOT1 del complejo CCR4 / NOT deadenilasa [67], lo que sugiere que BRAT, como SMG [68], puede inducir la desintegración de la transcripción a través de un mecanismo que implica el reclutamiento de deadenilasa para diana transcripciones.

Los ARNm unidos a PUM-RBD están enriquecidos en aquellos degradados tardíamente [59] y hemos demostrado aquí que los ARNm asociados a PUM inmunoprecipitados con nuestro Fab anti-PUM sintético están enriquecidos para las transcripciones maternas que experimentan una descomposición tardía. Dado que un subconjunto de ARNm asociados a BRAT también sufre una desintegración tardía, nuestros datos sugieren que la desintegración tardía mediada por BRAT podría implicar la cooperación con PUM. Como se discutió anteriormente, los ARNm dependientes de BRAT de Clase C se degradan de manera inequívoca a través de una vía tardía. Curiosamente, observamos una superposición significativa de los ARNm de Clase C con los asociados con PUM y BRAT (pero no con los objetivos solo de PUM) (Tabla 5 Archivo adicional 15), lo que sugiere que es probable que PUM y BRAT cooperen en la descomposición tardía de sus transcripciones de destino compartidas.


Unión específica de ARN por Q.beta. proteína de la capa

Las visualizaciones de artículos son la suma compatible con COUNTER de las descargas de artículos de texto completo desde noviembre de 2008 (tanto en PDF como en HTML) en todas las instituciones y personas. Estas métricas se actualizan periódicamente para reflejar el uso previo a los últimos días.

Las citas son la cantidad de otros artículos que citan este artículo, calculadas por Crossref y actualizadas diariamente. Encuentre más información sobre los recuentos de citas de Crossref.

El Altmetric Attention Score es una medida cuantitativa de la atención que ha recibido un artículo de investigación en línea. Al hacer clic en el ícono de dona, se cargará una página en altmetric.com con detalles adicionales sobre la puntuación y la presencia en las redes sociales del artículo dado. Encuentre más información sobre la puntuación de atención Altmetric y cómo se calcula la puntuación.

Nota: En lugar de un resumen, esta es la primera página del artículo.


RESULTADOS

Identificación de un sitio de unión de ARN de alta afinidad para SRp40.

Para identificar sitios de unión de ARN de alta afinidad para SRp40, optamos por utilizar el método SELEX (39) con SRp40 recombinante etiquetado con His, expresado y purificado a partir de Escherichia coli (HSRp40). Sin embargo, las proteínas SR están poco fosforiladas, si es que lo están, en las bacterias, y los dominios RS no fosforilados son muy básicos, lo que puede afectar las interacciones proteína-ARN. Anteriormente, buscamos superar este problema mediante el uso de versiones truncadas de proteínas SR que carecían de sus dominios RS en experimentos SELEX (38). En este estudio, evaluamos la influencia de la fosforilación del dominio RS en la especificidad de unión al ARN realizando SELEX con ambos sin fosforilar y in vitro HSRp40 fosforilado. Como se muestra en la Fig.1B, carril 2, HSRp40 no es reconocido por mAb104, lo que sugiere que el dominio RS no está fosforilado en E. coli. Para fosforilar HSRp40, la proteína se incubó en S100 durante 30 min en condiciones de empalme, se volvió a purificar en condiciones de desnaturalización y se renaturalizó. HSRp40 tratada de esta manera podría detectarse mediante transferencia Western con mAb104 (Fig.1B, carril 3) y mostró una movilidad electroforética mucho menor que la proteína no fosforilada (Fig.1A, carriles 1 y 2).

In vitro fosforilación de HSRp40 en HeLa S100. (A) Tinción de Coomassie de 3 μg de HSRp40 purificada (carril 1), y de in vitro HSRp40 fosforilado (ph.HSRp40) después de la purificación de S100 (carril 2). Las proteínas se resolvieron mediante SDS / PAGE al 9%.Los marcadores de masa molecular se muestran a la izquierda. (B) Análisis de transferencia Western con mAb104 de 150 ng de rSRp40 purificado (carril 1), HSRp40 (carril 2) y in vitro HSRp40 fosforilado (carril 3).

Luego realizamos SELEX con HSRp40 fosforilada y no fosforilada en paralelo. HSRp40 no fosforilado se unió de manera extremadamente estrecha al grupo inicial de ARN y no reveló un motivo de reconocimiento de consenso, incluso después de nueve ciclos de SELEX (resultados no mostrados). Por el contrario, solo se obtuvieron muy pocas secuencias diferentes con la proteína fosforilada después de siete ciclos. Como se muestra en la Fig. 2, 23 clones secuenciados representaron solo seis secuencias diferentes. De las dos secuencias encontradas con mayor frecuencia, una (pH1) se obtuvo nueve veces y la otra (pH23) seis veces. La secuencia de pH7, que se encontró una vez, es idéntica a pH23 excepto en una posición, mientras que pH2 es muy similar a pH1. La inspección de las secuencias de los ciclos anteriores indicó que pH23 se seleccionó predominantemente después de cinco ciclos, identificándolo así como la secuencia ganadora del experimento SELEX con HSRp40 fosforilada. Juntos, estos resultados sugieren que SRp40 es una proteína de unión a ARN específica de secuencia, y que se requiere la fosforilación del dominio RS para el reconocimiento de secuencias específicas.

Identificación de un sitio de unión de ARN de alta afinidad para SRp40 por SELEX con in vitro HSRp40 fosforilado. Se presentan las secuencias de clones individuales seleccionados después de los ciclos indicados. Los nucleótidos que se muestran en minúsculas pertenecen a la región constante flanqueante. Los números de la derecha indican el número de veces que se recuperó cada secuencia. Los nucleótidos que contribuyen a la secuencia de consenso (abajo) están representados en negrita.

El requisito de fosforilación del dominio RS para la unión específica de secuencia adecuada puede reflejar la posibilidad de que la carga altamente positiva del dominio no fosforilado oscurezca la unión específica de secuencia mediada por los dos dominios de unión de ARN. Alternativamente, el propio dominio RS fosforilado puede contribuir a la unión de ARN específica de secuencia. Para distinguir entre estas dos posibilidades y determinar si las secuencias SELEX son sitios de unión de SRp40 de alta afinidad, realizamos experimentos de cambio de movilidad en gel tanto con SRp40 purificada de células Sf9 infectadas con baculovirus (denominadas recombinantes o rSRp40) como con una bacteria. glutatión truncado expresado S-proteína de fusión de transferasa que carece del dominio RS (GSRp40ΔRS). La Fig. 3 muestra ensayos de cambio de movilidad en gel en los que se incubaron concentraciones crecientes de ambas proteínas con cantidades constantes de diversas secuencias de ARN radiomarcadas. Incluso a una concentración de 3 nM, rSRp40 se unió a pH7 (Fig.3A, carril 10) y ARN pH23 (Fig.3A, carril 19) con eficiencias altas e iguales. También se pudo detectar la unión a pH1, pero fue considerablemente más débil (Fig.3A, carriles 1-3). No se observó unión significativa con varias otras secuencias, incluidas dos secuencias recuperadas con HSRp40, H6 y H12 no fosforilados (Fig.3A, carriles 4-9), una secuencia que contiene un sitio de unión de alta afinidad rico en purinas para ASF / SF2 (38), A7 (Fig.3A, carriles 13-15), y una secuencia arbitraria, C2 (Fig. 3A, carriles 16-18). Los ensayos de gel-shift con GSRp40ΔRS dieron resultados muy similares a los obtenidos con rSRp40. Lo más importante es que la secuencia ganadora pH23 se unió a GSRp40ΔRS con mayor afinidad que cualquier otra secuencia probada (Fig.3B, carriles 10-12), aunque con menor afinidad que la rSRp40. Es posible que la menor afinidad se deba a la ausencia del dominio RS, pero también podría reflejar una propiedad del glutatión. S-proteína de fusión de transferasa. De nuestros resultados inferimos que el dominio RS de SRp40 no juega un papel significativo en la determinación de la especificidad de unión al ARN de la proteína.

Ensayos de cambio de movilidad en gel de rSRp40 y GSRp40ΔRS. Las sondas de ARN radiomarcadas se incubaron con concentraciones crecientes de rSRp40 (3, 15 y 75 nM) (A) o GSRp40ΔRS (8, 40 y 200 nM) (B). Los complejos de ARN libre y ARN-proteína se resolvieron mediante un gel no desnaturalizante de poliacrilamida al 5%. Las secuencias de H6 y H12 son GGGAGGAATGTCGCGTTCGGA y CGGAATGTCTTTACACTAC, respectivamente. Para la identificación de otras secuencias, consulte la Fig. 2 y la ref. 38 (A7, C2).

SRp40 en HeLa Nuclear Extracts se une de manera selectiva y eficiente a la secuencia ganadora de SELEX.

Para ampliar los resultados anteriores, determinamos a continuación si la SRp40 auténtica presente en extractos nucleares (NE) podría unirse selectivamente a la secuencia ganadora de SELEX (pH23, designada como B1). Con este fin, se incubó B1 radiomarcado durante 30 min en condiciones de empalme en S100, S100 suplementado con rSRp40 o NE, y luego se irradió con luz UV. Como se muestra en la Fig.4A, carril 3, la reticulación UV de B1 en S100 suplementado con rSRp40 produjo una banda fuerte que estaba ausente cuando se utilizó S100 solo (Fig.4A, carril 2). La reticulación UV de B1 en NE reveló una proteína que comigró con SRp40 (Fig.4A, carril 1), lo que sugiere fuertemente que la SRp40 auténtica en NE se une selectivamente a B1. Para confirmar este resultado, usamos un in vitro ensayo de selección en el que las proteínas se unieron al ARN de B1 biotinilado, se eliminaron de los extractos usando avidina agarosa y se visualizaron mediante análisis de transferencia Western con mAb104. B1 seleccionó fuertemente una proteína SR de 40 kDa cuando se añadió rSRp40 a S100 (Fig.4B, carril 6) pero no con S100 solo (Fig.4B, carril 5). Cuando se usó NE, mAb104 reconoció una proteína seleccionada que coincidía con rSRp40, lo que sugiere fuertemente que la proteína seleccionada de NE era SRp40 (Fig.4B, carril 4). La identidad de la proteína se confirmó mediante transferencia Western con anticuerpos anti-SRp40 policlonales purificados por afinidad (resultados no mostrados). Además de SRp40, también se seleccionó una proteína SRp30. La razón por la que esta proteína no fue detectada por reticulación UV puede residir en el hecho de que este ensayo, en contraste con el ensayo de biotina, usa cantidades limitantes de ARN. Por tanto, el último ensayo puede detectar proteínas que se unen al ARN con menor afinidad pero que son más abundantes. Llegamos a la conclusión de que B1 es reconocido eficazmente por SRp40 auténtico presente en NE.

La SRp40 auténtica presente en NE se une eficazmente al ARN de B1. (A) Reticulación UV de ARN B1 en NE (carril 1), S100 (carril 2) y S100 complementado con SRp40 50 nM (carril 3). Antes de la irradiación con UV, se incubó ARN de B1 radiomarcado durante 30 min en condiciones de empalme. Las proteínas reticuladas se resolvieron mediante SDS / PAGE al 10%. (B) Análisis de transferencia Western con mAb104 de proteínas seleccionadas por ARN B1 biotinilado, de NE (carril 4), S100 (carril 5) y S100 suplementado con rSRp40 50 nM (carril 6). Una fracción del material de entrada correspondiente se muestra en los carriles 1–3.

Los sitios de unión SRp40 de alta afinidad funcionan como un potenciador de empalme específico de SRp40 en Vitro.

Anteriormente mostramos que tres copias de un sitio de unión de alta afinidad para ASF / SF2 (A3) funcionan como un potenciador de empalme in vitro (38). El sustrato de prueba de potenciador de empalme (GN-A3) utilizado en ese estudio contenía la secuencia potenciadora A3 80 bases corriente abajo del segundo intrón de un gen de α-globina con un sitio de empalme 5 'débil modificado. Para probar si el sitio de unión de alta afinidad para SRp40 también podría poseer una función potenciadora, A3 se reemplazó en GN-A3 por tres copias de la secuencia seleccionada más seis nucleótidos 5 'de B1 (B3, Fig.5A). El pre-ARNm resultante, GN-B3, se empalmó en NE casi tan eficientemente como GN-A3 (Fig.5B, compare los carriles 1 a 4 y 9 a 12). Por el contrario, solo se obtuvo un empalme deficiente con un sustrato que contiene la secuencia B3 en la orientación antisentido (GN-B3 como Fig.5B, carriles 5-8). Dos copias de la secuencia multimerizada también mostraron una actividad significativa, aunque una sola copia de B1 estaba inactiva (no se muestran los resultados). A continuación, probamos si SRp40 se requería específicamente para la función potenciadora de B3. GN-B3 se empalmó de manera eficiente con una combinación de S100, la fracción nuclear NF20-40 (38) y rSRp40 (Fig.5C, carril 5). Como se informó anteriormente para GN-A3, el empalme de GN-B3 fue absolutamente dependiente de la presencia de NF20-40 (no se muestran los resultados), aunque no fue necesario para el empalme de PIP7A, un sustrato con sitios de empalme de consenso (Fig.5D). El empalme de GN-B3 también se observó cuando SRp40 se reemplazó por una preparación de proteínas SR clásicas de NE, pero apenas se detectó, si es que se detectó, con ASF / SF2 o SC35 recombinantes, que eran activos en PIP7A (comparar la Fig.5 C y D). Juntos, nuestros resultados indican que tres copias de un sitio de unión de SRp40 de alta afinidad funcionan como un potenciador de empalme in vitro, y que SRp40 se requiere específicamente para la activación del potenciador.

Tres copias de un sitio de unión de SRp40 de alta afinidad (B3) funcionan como un potenciador del empalme in vitro. (A) B3 contiene tres copias de la secuencia variable de B1 (negrita) más seis nucleótidos de la región flanqueante 5 '(subrayado). (B) In vitro empalme de sustratos de prueba potenciadores GN-A3, GN-B3as y GN-B3 (ver texto). In vitro El empalme se realizó durante los tiempos indicados. Los productos de empalme e intermedios se indican esquemáticamente. (C) In vitro empalme de GN-B3 durante 2 h en NE (carril 1), S100 (carril 2), NF20-40 (carril 3), como una combinación de S100 y NF20-40, complementado sin proteína (carril 4), SRp40 recombinante (carril 5), ASF / SF2 (carriles 6), SC35 (carril 7) o proteínas SR purificadas de NE (carril 8). (D) In vitro empalme de Pip7A (ver ref. 32) durante 90 min en NE (carril 1) y S100 suplementado con las proteínas SR indicadas (carriles 2-5). Las concentraciones de proteínas SR recombinantes utilizadas fueron 50 nM en todos los experimentos.

Las actividades de varios potenciadores de empalme previamente caracterizados parecen requerir complejos de proteínas SR, a diferencia de una única proteína SR (13, 35, 40). Para determinar si las proteínas SR además de SRp40 se ensamblan en B3, realizamos in vitro experimentos de selección con ARN de B3 biotinilado y análisis de transferencia Western de las proteínas seleccionadas con mAb104. Sorprendentemente, SRp40 fue la única proteína SR seleccionada eficazmente de NE por B3 (Fig. 6, carril 1). La identidad de la proteína SR seleccionada como SRp40 se confirmó de nuevo mediante transferencias Western con anticuerpos anti-SRp40 (datos no mostrados). SRp40 no fue seleccionado por B3 de NF20-40 (Fig. 6, carril 2) o S100 (Fig. 6, carril 3). Sin embargo, dos proteínas de aproximadamente 65 y 100 kDa, reconocidas por mAb104, se seleccionaron de NF20-40. Si bien se desconoce su papel en la activación del potenciador, si lo hay, nuestros resultados muestran que SRp40 es la única proteína SR clásica que se une al potenciador B3 de manera eficiente. Por tanto, un sitio de unión de SRp40 de alta afinidad puede formar un potenciador de empalme que es activado específicamente por SRp40.

SRp40 es la única proteína SR seleccionada eficazmente de NE por ARN B3. Análisis de transferencia Western de proteínas seleccionadas por ARN de B3 biotinilado usando mAb104. Las proteínas se seleccionaron de NE (carril 1), NF20-40 (carril 2), S100 (carril 3) o S100 suplementado con rSRp40 50 nM (carril 4). La migración de proteínas SR presentes en NE (no mostradas) se indica a la derecha.


Una proteína de unión a ARN específica de secuencia complementa a Apobec-1 para editar el ARNm de la apolipoproteína B

Figura 1 . La actividad complementaria interactúa con el ARN de apo-B in vitro. La actividad complementaria parcialmente purificada (10 mg) se incubó con las resinas de afinidad de ARN apo-B sentido o antisentido o con las perlas solas como se describe en Materiales y métodos. Después de un lavado extenso, las proteínas se eluyeron con NaCl 0,5 M. Las fracciones no unidas (proteína no unida más el primer lavado, 10 μg) y los eluidos (1 ng) se analizaron para determinar la actividad complementaria en presencia de His purificado.6-etiquetado apobec-1. El control del tampón y el material de partida (10 µg) se muestran en el primer panel. Las posiciones de los productos de extensión del cebador de los ARN editados (UAA) y sin editar (CAA) están marcadas a la derecha. Los datos se cuantificaron utilizando el software NIH ImageQuant y los resultados se expresan como el porcentaje de edición, es decir, UAA / (UAA + CAA). Figura 2 . La unión de la actividad complementaria al ARN de apo-B requiere la secuencia de amarre. (A) El porcentaje de edición de los ARN de apo-B de tipo salvaje y triple mutante se determinó en mezclas de reacción de edición que contenían actividad complementaria parcialmente purificada y His6-etiquetado apobec-1. (B) Se realizaron experimentos de unión in vitro con actividad complementaria parcialmente purificada y columnas de afinidad de ARN de apo-B de tipo salvaje (WT) o mutante. Se ensayó la actividad complementaria de las proteínas no unidas y eluidas como se describe en la leyenda de la Fig.1.

La actividad complementaria se copurifica con una proteína de 65 kDa que se reticula específicamente con el ARN de apo-B.

Fig. 3 . La reticulación con UV de una proteína de 65 kDa se correlaciona con la actividad complementaria. (A) La cromatografía de afinidad de ARN se realizó como se describe en Materiales y métodos. Los ensayos de edición se realizaron en las fracciones eluidas con sal 0,2, 0,5 o 1 M de la resina de afinidad de ARN de tipo salvaje. Los ensayos de edición se realizaron como se describe en la leyenda de la Fig. 1. (B) Se realizó reticulación UV con las fracciones eluidas con sal. Las proteínas se incubaron con ARN de tipo salvaje marcado con 32P y se expusieron a luz ultravioleta de onda corta durante 10 min. Después del tratamiento con RNasa A, las muestras se analizaron mediante SDS-PAGE al 7,5% y autorradiografía. Los estándares de tamaño molecular (en kilodaltons) se indican a la derecha de cada panel. La figura se generó utilizando ScanWizard 1.05 (Microtek) y Adobe Photoshop 3.05. Figura 4. Reticulación UV de una proteína de 65 kDa en los eluidos de resinas de afinidad de ARN. Los estudios de reticulación UV se realizaron como se describe en la leyenda de la Fig.3 con la fracción de sulfato de amonio del 15 al 30% (AMS) o con proteínas eluidas del tipo salvaje (eluido de WT), triple mutante (eluido de Mu), o columnas de afinidad de ARN antisentido (eluido de AS). Se utilizó como sonda ARN de apo-B de tipo salvaje marcado con 32P (A) o ARN de apo-B mutante (B). Las muestras se analizaron mediante SDS-PAGE al 10% y autorradiografía. Figura 5. Competencia por la reticulación de la proteína de 65 kDa. El ARN de apo-B de tipo salvaje marcado con 32P se incubó con proteínas eluidas de la columna de afinidad de ARN de tipo salvaje en ausencia de competidor (ninguno) o en presencia de un 2,5-, 5, 7,5-, 10- , o un exceso molar de 50 veces de ARN de apo-B de tipo salvaje no marcado, un exceso molar de 500 o 1000 veces del ARN triple mutante o un exceso molar de 500 veces del ARN de apo-B antisentido. La reticulación UV y SDS-8% PAGE se realizaron como se describe en la leyenda de la Fig. 3. La posición de la proteína de 65 kDa está indicada por una flecha. Los marcadores de tamaño molecular (en kilodaltons) se indican a la derecha.

La reticulación de la proteína de 65 kDa depende de la secuencia de amarre.

Figura 6. Reticulación UV con mutantes de translocación de luciferasa. Se realizaron experimentos de reticulación UV con proteínas eluidas de las columnas de afinidad de ARN de apo-B de tipo salvaje (A) o mutante (B). Las proteínas se incubaron con ARN de apo-B marcado con 32P, ARN de luciferasa de tipo salvaje (Luc 1) o los mutantes de translocación de luciferasa Luc 3 y Luc 4, que contienen 15 y 25 nt del casete de edición de apo-B, respectivamente. La reticulación UV se realizó como se describe en Materiales y métodos, y las muestras se analizaron mediante SDS-7.5% PAGE. La posición de los patrones de tamaño molecular (en kilodaltons) se indica a la derecha y la posición de la proteína de 65 kDa se indica con una flecha.

Identificación de una proteína de 65 kDa que interactúa con apobec-1 y se copurifica con la actividad complementaria.

Figura 7. Correlación de la actividad complementaria con una proteína de 65 kDa. (A) Las proteínas eluidas de las columnas de afinidad de ARN de tipo salvaje (WT) o mutante se analizaron directamente o después de la reticulación con UV al ARN de apo-B marcado. Las muestras no tratadas y reticuladas con UV se sometieron a electroforesis en paralelo en el mismo gel SDS-8% PAGE. La mitad del gel se tiñó con plata, mientras que la otra mitad se reveló mediante autorradiografía. La posición de la proteína de 65 kDa está indicada por una flecha. (B) Resultados del análisis Far-Western con apobec-1 marcado con [35 S] cisteína como sonda. Las proteínas purificadas por afinidad de las columnas de ARN de tipo salvaje o mutante se resolvieron mediante SDS-PAGE al 8% y se transfirieron a membranas de difluoruro de polivinilideno como se describe en Materiales y métodos. Las proteínas se sometieron a múltiples ciclos de desnaturalización y renaturalización y se sondaron con apobec-1 marcado con [35 S] cisteína.

Purificación adicional de la actividad complementaria mediante cromatografía de afinidad de ARN.

Figura 8. Purificación de la actividad complementaria mediante cromatografía de afinidad de ARN. La actividad complementaria parcialmente purificada se incubó con la resina de afinidad de ARN de triple mutante (Mu). Después de esta etapa de aclaramiento previo, la fracción no unida se cargó en la resina de afinidad de ARN de tipo salvaje (WT). Las proteínas unidas se eluyeron con tampón que contenía sal 0,5 M. (A) Las fracciones no unidas y la fracción eluida con sal 0,5 M se ensayaron para determinar la actividad complementaria. (B) Una alícuota de la fracción purificada por afinidad también se resolvió mediante SDS-PAGE al 8% y se analizó mediante tinción con plata.

1. Introducción

Las proteínas de unión al ARN (RBP) son actores clave en el metabolismo y la función del ARN. Se unen a moléculas de ARN a través de elementos reguladores en cis para coordinar procesos postranscripcionales como el empalme, el transporte de ARN, la estabilidad y la localización del ARN (Keene, 2007). Hay cientos de RBP codificadas en genomas eucariotas (Baltz et al., 2012), cada uno con funciones específicas, por lo que es necesario que las RBP reconozcan sus objetivos de ARN con alta especificidad. El conocimiento actual es que esta especificidad de unión se logra mediante combinaciones de secuencia de ARN y propiedades de estructura, en proporciones variables (Cook et al., 2015). Algunas RBP prefieren unirse al ARN monocatenario y reconocer su objetivo solo por la composición de nucleótidos, mientras que otras prefieren contextos estructurales específicos. Para la mayoría de las RBP, sin embargo, solo se ha determinado un motivo de secuencia primaria, mientras que la estructura de los sitios de unión no está caracterizada.

Las interacciones RBP-RNA se evalúan experimentalmente con alto rendimiento in vitro o en vivo métodos. los in vitro enfoques, como RNAcompete (Ray et al., 2009), determinan la especificidad y afinidad de unión de una proteína específica a millones de ARN sintéticos cortos, en ausencia de otras proteínas o factores celulares, mientras que en vivo Los métodos determinan los sitios de unión de una determinada proteína en un contexto celular específico. Existen varios métodos de reticulación e inmunoprecipitación (CLIP) (Hafner et al., 2010 Konig et al., 2010 Ule et al., 2003) que inducen enlaces cruzados permanentes entre ARN y RBP en vivo, después de lo cual se aíslan los fragmentos de RBP-ARN mediante inmunoprecipitación y se secuencian los segmentos de ARN reticulado.

El análisis computacional de las interacciones RBP-RNA es vital para interpretar los datos experimentales y finalmente comprender cómo un RBP encuentra y se une a sus objetivos. Encontrar motivos de secuencia no es trivial debido a la brevedad del motivo de unión y al gran número de secuencias de entrada que pueden incluir muchos falsos positivos. La incorporación de preferencias de estructura secundaria en modelos de motivos agrega una capa adicional de desafíos debido al ruido de la predicción de la estructura del ARN y la necesidad de un modelo confiable para motivos de estructura de secuencia que también sea fácil de interpretar. Los motivos de unión a RBP se pueden derivar con métodos desarrollados para proteínas de unión a ADN, que consideran solo la secuencia primaria de ARN, o con herramientas diseñadas específicamente que dan cuenta de diferentes niveles de información de estructura secundaria. Los primeros buscadores de motivos diseñados para RBP utilizaron la estructura secundaria de ARN como conocimiento previo para restringir la búsqueda de motivos de secuencia a regiones monocatenarias o estructuras de bucle específicas (Foat y Stormo, 2009 Hiller et al., 2006 Li et al., 2010). Las herramientas más recientes utilizan diferentes estrategias para modelar y predecir tanto motivos de secuencia como de estructura. ARNcontext (Kazán et al., 2010) detecta las preferencias relativas de un RBP para múltiples contextos estructurales. Utiliza un marco probabilístico para modelar por separado las preferencias de secuencia y estructura, y fue diseñado para trabajar con datos de afinidad de unión de RNAcompete. Aunque también se aplicó a conjuntos de datos CLIP, su rendimiento en este caso no está establecido. GraphProt (Maticzka et al., 2014) aprende las preferencias de enlace de secuencia y estructura de los RBP modelando los sitios de enlace como hipergráficos. Utiliza máquinas de vectores de soporte (SVM) basadas en kernel de gráficos para clasificar entre regiones vinculadas y no vinculadas. El modelo enlazado predicho es difícil de interpretar o visualizar, y la herramienta genera las 1000 secuencias y estructuras con mejor puntuación, que se pueden convertir a PWM o logotipos. Zagros (Bahrami-Samani et al., 2015) es una extensión del algoritmo MEME diseñado para datos CLIP. Tiene en cuenta los eventos de modificación de enlaces cruzados y la estructura secundaria en forma de probabilidades emparejadas no emparejadas. Zagros utiliza como entrada solo los sitios de enlace derivados de datos experimentales y realiza de novo descubrimiento de motivos. Estos buscadores de motivos están diseñados específicamente para un cierto tipo de datos experimentales y solo Zagros encuentra de novo motivos de estructura secuencial, mientras que ARNcontext y GraphProt trabajar en entornos de clasificación o regresión. Además, las predicciones de la estructura de todas las herramientas no se evaluaron objetivamente.

En este artículo, presentamos SSMART (herramienta de análisis de motivos de secuencia-estructura para proteínas de unión a ARN), un buscador de motivos de ARN que extiende cERMIT (Georgiev et al., 2010): un buscador de motivos basado en secuencias que se utiliza principalmente para determinar las preferencias de unión al ADN a partir de datos de alto rendimiento como ChIP-seq. Nuestra herramienta identifica motivos de unión modelando simultáneamente la secuencia primaria y la estructura secundaria del ARN y buscando motivos de estructura de secuencia óptimos de longitudes flexibles. Los motivos de secuencia-estructura se representan como cadenas de consenso sobre un alfabeto degenerado, extendiendo los códigos IUPAC para nucleótidos para reflejar también preferencias de estructura secundaria. La estructura secundaria se obtiene en un paso previo, muestreando estructuras subóptimas alrededor de los sitios de unión e identificando combinaciones dominantes locales de pares de bases (Rogers y Heitsch, 2014). Los candidatos a motivo se evalúan con una función objetiva que integra las dianas de ARN individuales que vinculan la evidencia en una puntuación combinada. La función objetivo se optimiza con una estrategia de búsqueda codiciosa que comienza con un conjunto de 4-mers sobre el alfabeto de estructura de secuencia no degenerada. Cada uno de estos motivos "semilla" se "evoluciona" iterativamente hasta que la puntuación del motivo ya no puede mejorarse. Después de que se hayan desarrollado todas las semillas del motivo, SSMART aplica un paso de posprocesamiento en el que los motivos evolucionados se agrupan y los PWM correspondientes se generan a partir de candidatos de alta puntuación (Fig. 1C).

Descripción general del flujo de trabajo del buscador de motivos. (A) Elaboración de conjuntos de datos sintéticos. (B) Preprocesamiento de lecturas CLIP. CS se refiere a la especificidad de conversión de T a C y expr a la expresión génica. (C) SSMART algoritmo. Un conjunto de semillas de 4 unidades se desarrolla de forma independiente para optimizar la puntuación en la lista clasificada de sitios de unión. Luego, los motivos se agrupan y se informan los mejores motivos de estructura de secuencia. Representamos los dos componentes por separado: la parte superior corresponde al logotipo de la secuencia, mientras que la parte inferior representa la probabilidad de estar emparejados (debajo de la línea) y no emparejados (arriba de la línea) para cada base.

Descripción general del flujo de trabajo del buscador de motivos. (A) Elaboración de conjuntos de datos sintéticos. (B) Preprocesamiento de lecturas CLIP. CS se refiere a la especificidad de conversión de T a C y expr a la expresión génica. (C) SSMART algoritmo. Un conjunto de semillas de 4 unidades se desarrolla de forma independiente para optimizar la puntuación en la lista clasificada de sitios de unión. Luego, los motivos se agrupan y se informan los mejores motivos de estructura de secuencia. Representamos los dos componentes por separado: la parte superior corresponde al logotipo de la secuencia, mientras que la parte inferior representa la probabilidad de estar emparejados (debajo de la línea) y no emparejados (arriba de la línea) para cada base.

Las evaluaciones sobre datos sintéticos mostraron que SSMART es capaz de recuperar la secuencia de RBP y los motivos de estructura implantados en secuencias de tipo 3'UTR, en diversas proporciones de sitios de unión estructurados / no estructurados. Usamos exitosamente SSMART en alto rendimiento en vivo y in vitro datos, que muestran que no solo recuperamos el motivo de secuencia conocido, sino que también obtenemos información sobre las preferencias estructurales de la RBP.


Discusión

En este informe identificamos Hrp1p como un componente novedoso de la maquinaria de poliadenilación en la levadura. S. cerevisiae. La evidencia de que Hrp1p participa tanto en la escisión del pre-mRNA como en la posterior adición de colas de poli (A) se basa en resultados tanto in vivo como in vitro. Células portadoras de mutantes HRP1 Los alelos contienen ARNm con colas poli (A) aberrantemente cortas y muestran letalidad sintética en combinación con mutaciones en ARN14 y ARN15,que codifican proteínas necesarias para la escisión y poliadenilación. Esta interacción fue confirmada por análisis de dos híbridos. Hrp1p es la proteína de 73 kD de CF IB, que también es necesaria para ambos pasos de la reacción de procesamiento in vitro. Además, una proteína de fusión GST-Hrp1 recombinante puede sustituir completamente la función de la CF IB.

En S. cerevisiae, tres elementos son suficientes para especificar un sitio poli (A) (Guo y Sherman 1996). Estos incluyen un motivo PyA en el sitio de escisión, el elemento de eficiencia rico en UA y el elemento de posicionamiento rico en A. La formación adecuada del ARNm del extremo 3 'requiere el reconocimiento de los tres cis-secuencias de acción. Actualmente, existen varias proteínas de unión a ARN que podrían estar reconociendo estas señales: Rna15p, Cft2p y, recientemente, una tercera, Hrp1p. La subunidad Rna15p de CF IA se puede reticular a GAL7 ARN, y esta interacción no requiere el elemento de eficiencia (Kessler et al. 1996). Por otro lado, la reticulación de la subunidad Cft2 de CF II (Zhao et al. 1997) y Hrp1p requieren el elemento de eficiencia. Sin embargo, la unión de Cft2p depende de ATP, mientras que la unión de Hrp1p no lo hace y, a diferencia de Cft2p, Hrp1p se une a sustratos no escindidos y escindidos. El componente Yth1p de PF I se une preferentemente a poli (U), pero su sitio de unión en el ARN precursor sigue siendo desconocido (Barabino et al. 1997).

Estas interacciones sugieren que el ensamblaje de un complejo de escisión funcional puede ser un proceso dinámico por pasos (Fig. 7). Por ejemplo, la interacción de CF II puede ser un paso temprano en el reconocimiento de pre-ARNm y necesaria para el reclutamiento de los otros factores de escisión, CF IA y Hrp1p. Esta posibilidad sería consistente con nuestras observaciones de que CF II mejora la unión de Hrp1p al ARN de longitud completa. Entonces, CF II puede ser desplazado del elemento de eficiencia por Hrp1p, que permanece en el ARN escindido durante la adición de poli (A), por lo tanto, el requisito de Hrp1p para ambas etapas de la reacción. Muchos sitios de levadura tienen múltiples elementos de eficiencia. A este respecto, también es interesante que Hrp1p tenga dos motivos RRM, lo que puede permitirle entrar en contacto con más de un elemento de eficiencia simultáneamente.

Esquema de la dinámica de Hrp1p. El pre-ARNm es inicialmente reconocido por CF II que interactúa en el elemento de eficiencia rico en UA. El reclutamiento de Hrp1p y CF IA en el complejo desplaza a CF II, pero la asociación continua de CF II puede estabilizar la unión de Hrp1p. Hrp1p y CF IA permanecen unidos al ARN escindido y promueven la adición de poli (A) en combinación con PF I, PAP y Pab1p. Después de este paso, Hrp1p permanece unido al ARNm junto con otras proteínas de unión al ARN como Npl3p y Pab1p. Junto con el ARNm procesado, las proteínas saldrían del núcleo en el poro nuclear, se disociarían del ARNm y volverían a entrar en el núcleo mediante el reconocimiento de Kap104p en el caso de Hrp1p y un receptor de transporte nuclear aún no definido para Npl3p. Se desconocen los movimientos de Pab1p.

Nosotros y otros hemos encontrado que la proteína Pab1 se cofracciona con la actividad CF I (Fig. 1C Minvielle-Sebastia et al. 1997), de acuerdo con su interacción con Rna15p en ensayos de dos híbridos y coinmunoprecipitación (Amrani et al. 1997b). Pab1p está asociado con las colas poli (A) del ARNm en el citoplasma, donde estimula el inicio de la traducción (Sachs et al. 1997). Usando un sistema completamente reconstituido con fracciones purificadas en lugar de la complementación de extractos empobrecidos en Pab1p, pudimos diseccionar aún más el papel de Pab1p en la formación del extremo 3 'del ARNm. Una combinación de Hrp1p, CF IA, PAP y PF I son suficientes para la adición de poli (A), pero Pab1p actúa para limitar el tamaño de la cola de poli (A) final y no es necesaria para la escisión. Este hallazgo es consistente con el hecho de que las células que tienen una temperatura sensible pab1 la mutación mostró colas de poli (A) aberrantemente largas in vivo (Sachs y Deardorff 1992) e in vitro (Amrani et al. 1997b Minvielle-Sebastia et al. 1997). También verifica el resultado anterior de que la adición de anticuerpos anti-Pab1p a un extracto de procesamiento provoca un aumento en la longitud de poli (A) pero no tuvo ningún efecto sobre la reacción de escisión (Amrani et al. 1997b).

HRP1 se identificó originalmente porque las mutaciones suprimieron la sensibilidad a la temperatura y el defecto de exportación de ARNm denpl3 ts mutantes (Henry et al. 1996). NPL3codifica una proteína de unión a ARN poli (A) + principal y reside principalmente en el núcleo (Bossie et al. 1992 Russel y Tollervey 1992 Wilson et al. 1994). Sin embargo, Npl3p se desplaza rápidamente entre el núcleo y el citoplasma de una manera que depende de la síntesis de ARNm (Flach et al. 1994 Lee et al. 1996). Esto ha llevado a la idea de que Npl3p es un mediador principal de la exportación de ARNm y puede actuar de manera similar a otras ribonucleoproteínas nucleares heterogéneas (hnRNP), como hnRNP A1. Un modelo es que las proteínas como Npl3p se asocian con el ARNm recién sintetizado y contienen "señales" que se dirigen al complejo proteína-ARN para exportarlo fuera del núcleo (Nakielny y Dreyfuss 1997).

Hay varias explicaciones posibles de por qué una forma mutante de Hrp1p, una proteína involucrada en la poliadenilación (como hemos demostrado aquí), podría compensar la pérdida de función de un factor de transporte nuclear como Npl3p. Una posibilidad es que la exportación de ARNm se pueda considerar como parte de una vía orquestada, por ejemplo, transcripción, protección, empalme, poliadenilación y exportación. Si se requiere Npl3p para el paso de exportación, quizás mediante la mutación de proteínas como Hrp1p, la célula puede compensar la presencia de un Npl3p defectuoso más adelante en la ruta. Otra posibilidad es que proteínas como Npl3p y Hrp1p empaqueten el ARN para la exportación. Quizás Hrp1p se une al ARNm durante la reacción de poliadenilación y permanece asociado con él a medida que sale del núcleo al citoplasma. Nuestro hallazgo de que Hrp1p es capaz de salir del núcleo es consistente con este punto de vista. Una vez en el citoplasma, Hrp1p tendría que ser liberado del ARNm y reimportado al núcleo. Curiosamente, Hrp1p parece usar un receptor de importación nuclear especial, denominado Kap104p en levadura, que es similar a la transportina de mamíferos (Aitchison et al. 1996). La transportina es necesaria para la importación de la proteína hnRNP A1 al núcleo. Esta vista de la dinámica de la proteína Hrp1 se presenta en la Figura 7.

Está claro que Hrp1p se parece al hnRNP A1 de mamífero en estructura, con dos RRM y un dominio carboxilo rico en RGG, y en la capacidad de desplazarse desde el núcleo al citoplasma, incluso utilizando un receptor de importación nuclear similar. HnRNP A1 puede influir en la elección del sitio de empalme pero no tiene ningún papel conocido en la poliadenilación de mamíferos (Weighardt et al. 1996). Nuestro estudio plantea preguntas sobre por qué la Hrp1p es necesaria para la poliadenilación en levaduras y por qué no se conocen contrapartes en las células metazoarias. Existe una similitud de secuencia entre muchas de las proteínas que se encuentran en la levadura y los factores de procesamiento de los mamíferos. Dado el nivel de conservación emergente (Manley y Takagaki 1996), bien puede haber una proteína similar a Hrp1p esperando ser descubierta. De esta manera, Hrp1p puede ser la primera pista de un mecanismo común que une la poliadenilación y la exportación de ARNm en eucariotas.

Por otro lado, puede que no exista un equivalente mamífero de Hrp1p y puede representar una adaptación especial para compensar en la levadura los mecanismos reguladores del transporte que se perdieron durante la evolución. En general, el ARN sin empalmar no sale del núcleo a menos que esté complejado con proteínas que le permitan eludir la maquinaria de transporte de ARNm normal (Nakielny y Dreyfuss 1997). Además, con los múltiples intrones de la mayoría de los pre-ARNm de mamíferos, es probable que el ARN se poliadenila mucho antes de que se complete el corte y empalme, de modo que la célula depende de la asociación de factores de corte y empalme para retener ARN inmaduros en el núcleo. En la levadura, pocos genes tienen intrones, y puede ser necesario monitorear más de cerca la formación del extremo 3 'como la marca de un ARNm maduro y acoplar este evento al transporte rápido.

En este estudio hemos utilizado tanto la genética de la levadura como la bioquímica para demostrar que la proteína de unión al ARN Hrp1p es una parte esencial de la maquinaria de poliadenilación en la levadura. Como tal, es el primer ejemplo de un factor de procesamiento de ARNm constitutivo que probablemente se mueve con el ARNm fuera del núcleo. Los experimentos futuros abordarán el mecanismo preciso por el cual funciona Hrp1p y cómo sirve para coordinar el procesamiento del ARNm con el transporte.


Referencias

Ahmed, E. A. y de Rooij, D. G. (2009). Estadificación de secciones transversales de túbulos seminíferos de ratón. Methods Mol. Biol. 558, 263 & # x2013277. doi: 10.1007 / 978-1-60761-103-5_16

Albihlal, W. S. y Gerber, A. P. (2018). Proteínas de unión a ARN no convencionales: una zona desconocida en la biología del ARN. FEBS Lett. 592, 2917 y # x20132931. doi: 10.1002 / 1873-3468.13161

Auer, J., Stoddart, J. J., Christodoulou, I., Lima, A., Skouloudaki, K., Hall, H. N., et al. (2020). De números y movimiento: comprensión de la patogénesis del factor de transcripción mediante microscopía avanzada. Dis. Modelo. Mech. 13: dmm046516. doi: 10.1242 / dmm.046516

Beckmann, B. M., Horos, R., Fischer, B., Castello, A., Eichelbaum, K., Alleaume, A. M., et al. (2015). Los proteomas de unión a ARN de la levadura al hombre albergan enigmRBP conservadas. Nat. Comun. 6: 10127. doi: 10.1038 / ncomms10127

Bracke, A., Peeters, K., Punjabi, U., Hoogewijs, D. y Dewilde, S. (2018). Una búsqueda de los mecanismos moleculares que subyacen a la infertilidad idiopática masculina. Reprod. Biomed. En línea. 36, 327 y # x2013339. doi: 10.1016 / j.rbmo.2017.12.005

Brackley, K. I. y Grantham, J. (2009). Actividades de la chaperonina que contiene TCP-1 (CCT): implicaciones para la progresión del ciclo celular y la organización citoesquelética. Chaperones de estrés celular 14, 23 & # x201331. doi: 10.1007 / s12192-008-0057-x

Cao, X., Cui, Y., Zhang, X., Lou, J., Zhou, J., Bei, H. y col. (2018). Perfil proteómico de espermatozoides humanos en individuos sanos y astenozoospérmicos. Reprod. Biol. Endocrinol. 16:16. doi: 10.1186 / s12958-018-0334-1

Chalmel, F. y Rolland, A. D. (2015). Vinculación de la transcriptómica y la proteómica en la espermatogénesis. Reproducción 150, R149 y # x2013R157. doi: 10.1530 / REP-15-0073

Connolly, C. M., Dearth, A. T. y Braun, R. E. (2005). La interrupción de Tenr murino produce teratospermia e infertilidad masculina. Dev. Biol. 278, 13 & # x201321. doi: 10.1016 / j.ydbio.2004.10.009

Counts, J. T., Hester, T. M. y Rouhana, L. (2017). La expansión genética de las subunidades del complejo TCP-1 que contienen chaperonina (CCT / TRiC) produce isoformas específicas de testículo necesarias para la espermatogénesis en gusanos planos de las planarias. Mol. Reprod. Dev. 84, 1271 & # x20131284. doi: 10.1002 / mrd.22925

Cuvelier, E., M & # x00E9quinion, M., Leghay, C., Sibran, W., Stievenard, A., Sarchione, A., et al. (2018). La sobreexpresión de alfa-sinucleína humana de tipo salvaje provoca anomalías en el metabolismo en ratones transgénicos Thy1-aSYN. Parte delantera. Mol. Neurosci. 11: 321. doi: 10.3389 / fnmol.2018.00321

Griswold, M. D. (2016). Espermatogénesis: la apuesta por la meiosis. Physiol. Rvdo. 96, 1 ​​& # x201317. doi: 10.1152 / physrev.00013.2015

Grosso, A. R., Gomes, A. Q., Barbosa-Morais, N. L., Caldeira, S., Thorne, N. P., Grech, G., et al. (2008). Firmas de expresión génica del factor de empalme específico de tejido. Res de ácidos nucleicos. 36, 4823 y # x20134832. doi: 10.1093 / nar / gkn463

Hardison, R. C., Zhang, Y., Keller, C. A., Xiang, G., Heuston, E. F., An, L., et al. (2020). La integración sistemática de factores de transcripción GATA y epigenomas a través de IDEAS pinta el panorama regulador de las células hematopoyéticas. Vida IUBMB 72, 27 & # x201338. doi: 10.1002 / iub.2195

Hentze, M. W., Castello, A., Schwarzl, T. y Preiss, T. (2018). Un nuevo y valiente mundo de proteínas de unión a ARN. Nat. Rev. Mol. Biol celular. 19, 327 & # x2013341.doi: 10.1038 / nrm.2017.130

Herzel, L., Ottoz, D., Alpert, T. y Neugebauer, K. M. (2017). Base táctil de empalme y transcripción: ensamblaje y función del espliceosoma co-transcripcional. Nat. Rev. Mol. Biol celular. 18, 637 & # x2013650. doi: 10.1038 / nrm.2017.63

Idler, R. K. y Yan, W. (2012). Control del destino del ARN mensajero mediante proteínas de unión a ARN: énfasis en la espermatogénesis de mamíferos. J. Androl. 33, 309 y # x2013337. doi: 10.2164 / jandrol.111.014167

Iguchi, N., Tobias, J. W. y Hecht, N. B. (2006). El perfil de expresión revela ARNm de células germinativas masculinas meióticas que se regulan de forma ascendente y descendente traslacionalmente. Proc. Natl. Acad. Sci. ESTADOS UNIDOS. 103, 7712 y # x20137717. doi: 10.1073 / pnas.0510999103

Jin, M., Liu, C., Han, W. y Cong, Y. (2019). Chaperonina TRiC / CCT: estructura y función. Bioquímica subcelular. 93, 625 & # x2013654. doi: 10.1007 / 978-3-030-28151-9_19

Kang, D., Lee, Y. y Lee, J. S. (2020). Proteínas de unión a ARN en cáncer: perspectivas funcionales y terapéuticas. Cánceres 12: 2699. doi: 10.3390 / cancers12092699

Kotaja, N. y Sassone-Corsi, P. (2007). El cuerpo cromatoide: un centro de procesamiento de ARN específico de células germinales. Nat. Rev. Mol. Cell Biol. 8, 85 y # x201390. doi: 10.1038 / nrm2081

Kwon, S. C., Yi, H., Eichelbaum, K., F & # x00F6hr, S., Fischer, B., You, K. T., et al. (2013). El repertorio de proteínas de unión a ARN de las células madre embrionarias. Nat. Struct. Mol. Biol. 20, 1122 & # x20131130. doi: 10.1038 / nsmb.2638

Latendresse, J. R., Warbrittion, A. R., Jonassen, H. y Creasy, D. M. (2002). Fijación de testículos y ojos usando un fluido Davidson & # x2019s modificado: comparación con el fluido Bouin & # x2019s y el fluido Davidson & # x2019s convencional. Toxicol. Pathol. 30, 524 & # x2013533. doi: 10.1080 / 01926230290105721

Lehti, M. S. y Sironen, A. (2016). Formación y función de manchette y flagellum durante la espermatogénesis. Reproducción 151, R43 y # x2013R54. doi: 10.1530 / REP-15-0310

Lehti, M. S. y Sironen, A. (2017). Formación y función de las estructuras de la cola de los espermatozoides en asociación con defectos de motilidad de los espermatozoides. Biol. Reprod. 97, 522 y # x2013536. doi: 10.1093 / biolre / iox096

Matsumoto, T., Kinoshita, T., Matsuzaka, H., Nakai, R., Kirii, Y., Yokota, K., et al. (2012). Estructura cristalina de MAP2K6 no fosforilado en un estado de autoinhibición putativo. J. Biochem. 151, 541 & # x2013549. doi: 10.1093 / jb / mvs023

Meijer, H. A., Bushell, M., Hill, K., Gant, T. W., Willis, A. E., Jones, P., et al. (2007). Un método novedoso para el fraccionamiento de poli (A) revela una gran población de ARNm con una cola corta de poli (A) en células de mamíferos. Res de ácidos nucleicos. 35, e132. doi: 10.1093 / nar / gkm830

Moraes, C. R. y Meyers, S. (2018). La mitocondria de los espermatozoides: orgánulo de muchas funciones. Anim. Reprod. Ciencia. 194, 71 & # x201380. doi: 10.1016 / j.anireprosci.2018.03.024

Neto, F. T., Bach, P. V., Najari, B. B., Li, P. S. y Goldstein, M. (2016). Espermatogénesis en humanos y sus factores que la afectan. Semin. Cell Dev. Biol. 59, 10 & # x201326. doi: 10.1016 / j.semcdb.2016.04.009

North, M. A., Naggert, J. K., Yan, Y., Noben-Trauth, K. y Nishina, P. M. (1997). Caracterización molecular de TUB, TULP1 y TULP2, miembros de la nueva familia de genes tubby y su posible relación con enfermedades oculares. Proc. Natl. Acad. Sci. ESTADOS UNIDOS. 94, 3128 y # x20133133. doi: 10.1073 / pnas.94.7.3128

O & # x2019 Donnell, L. (2015). Mecanismos de espermiogénesis y espermiación y cómo se alteran. Espermatogénesis 4: e979623. doi: 10.4161 / 21565562.2014.979623

Ozturk, N., Steger, K. y Schagdarsurengin, U. (2017). El impacto de la autofagia en la espermiogénesis. Asiático. J. Androl. 19, 617 y # x2013618. doi: 10.4103 / 1008-682X.190324

Ozturk, S. y Uysal, F. (2018). Funciones potenciales de las proteínas de unión a poli (A) en la regulación de la traducción durante la espermatogénesis. J. Reprod. Dev. 64, 289 & # x2013296. doi: 10.1262 / jrd.2018-026

Paronetto, M. P. y Sette, C. (2010). Papel de las proteínas de unión a ARN en la espermatogénesis de mamíferos. En t. J. Androl. 33, 2 & # x201312. doi: 10.1111 / j.1365-2605.2009.00959.x

Pleuger, C., Lehti, M. S., Dunleavy, J. E., Fietz, D. y O & # x2019 Bryan, M. K. (2020). Células germinales masculinas haploides: la gran estación central del transporte de proteínas. Tararear. Reprod. Actualizar 26, 474 y # x2013500. doi: 10.1093 / humupd / dmaa004

Ray, D., Ha, K., Nie, K., Zheng, H., Hughes, T. R. y Morris, Q. D. (2017). Metodología y aplicación de RNAcompete para determinar las preferencias de secuencia de proteínas de unión a RNA no convencionales. Métodos 11, 3 & # x201315. doi: 10.1016 / j.ymeth.2016.12.003

Ray, P. F., Toure, A., Metzler-Guillemain, C., Mitchell, M. J., Arnoult, C. y Coutton, C. (2017). Anormalidades genéticas que conducen a defectos cualitativos de la morfología o función de los espermatozoides. Clin. Gineta. 91, 217 & # x2013232. doi: 10.1111 / cge.12905

Salas-Huetos, A., Bull & # x00F3, M. y Salas-Salvad & # x00F3, J. (2017). Patrones dietéticos, alimentos y nutrientes en los parámetros de fertilidad masculina y fecundabilidad: una revisión sistemática de estudios observacionales. Tararear. Reprod. Actualizar 23, 371 & # x2013389. doi: 10.1093 / humupd / dmx006

Schrans-Stassen, B. H., Saunders, P. T., Cooke, H. J. y de Rooij, D. G. (2001). Naturaleza de la detención espermatogénica en ratones Dazl - / -. Biol. Reprod. 65, 771 & # x2013776. doi: 10.1095 / biolreprod65.3.771

Shen, B., Zhang, J., Wu, H., Wang, J., Ma, K., Li, Z. y col. (2013). Generación de ratones genéticamente modificados a través de direccionamiento génico mediado por Cas9 / ARN. Res celular. 23, 720 & # x2013723. doi: 10.1038 / cr.2013.46

Sutherland, J. M., Siddall, N. A., Hime, G. R. y McLaughlin, E. A. (2015). Proteínas de unión a ARN en la espermatogénesis: un enfoque en profundidad sobre la familia Musashi. Asiático. J. Androl. 17, 529 & # x2013536. doi: 10.4103 / 1008-682X.151397

Tour & # x00E9, A., Martínez, G., Kherraf, Z. E., Cazin, C., Beurois, J., Arnoult, C., et al. (2020). La arquitectura genética de las anomalías morfológicas de la cola del esperma. Tararear. Gineta. [Publicación electrónica antes de la impresión]. doi: 10.1007 / s00439-020-02113-x

Vallin, J. y Grantham, J. (2019). El papel de la chaperona molecular CCT en el plegamiento de proteínas y la mediación de los procesos asociados al citoesqueleto: implicaciones para la biología de las células cancerosas. Chaperones de estrés celular 24, 17 & # x201327. doi: 10.1007 / s12192-018-0949-3

Vander Borght, M. y Wyns, C. (2018). Fertilidad e infertilidad: definición y epidemiología. Clin. Bioquímica. 62, 2 & # x201310. doi: 10.1016 / j.clinbiochem.2018.03.012

Vanderweyde, T., Youmans, K., Liu-Yesucevitz, L. y Wolozin, B. (2013). Papel de los gránulos de estrés y las proteínas de unión al ARN en la neurodegeneración: una mini revisión. Gerontología 59, 524 & # x2013533. doi: 10.1159 / 000354170

Wang, M., Xu, Z. y Kong, Y. (2018). El reino de las proteínas tubby-like en animales y plantas. Gene 642, 16 & # x201325. doi: 10.1016 / j.gene.2017.10.077

Wen, Q., Tang, E. I., Xiao, X., Gao, Y., Chu, D. S., Mruk, D. D., et al. (2016). Transporte de células germinales a través del epitelio seminífero durante la espermatogénesis, la participación de citoesqueletos basados ​​en actina y microtúbulos. Barreras de tejidos 4: e1265042. doi: 10.1080 / 21688370.2016.1265042

Xing, S., Gai, K., Li, X., Shao, P., Zeng, Z., Zhao, X., et al. (2019). Tcf1 y Lef1 son necesarios para la función inmunosupresora de las células T reguladoras. J. Exp. Medicina. 216, 847 & # x2013866. doi: 10.1084 / jem.20182010

Zagore, L. L., Grabinski, S. E., Sweet, T. J., Hannigan, M. M., Sramkoski, R. M., Li, Q., et al. (2015). La proteína de unión al ARN Ptbp2 es esencial para el desarrollo de células germinales masculinas. Mol. Biol celular. 35, 4030 y # x20134042. doi: 10.1128 / MCB.00676-15

Zakrzewski, P., Lenartowska, M. y Buss, F. (2021). Diversas funciones de la miosina VI en la espermiogénesis. Histochem. Biol celular. [Publicación electrónica antes de la impresión]. doi: 10.1007 / s00418-020-01954-x

Zhu, F., Yan, P., Zhang, J., Cui, Y., Zheng, M., Cheng, Y. y col. (2019). La deficiencia de TPPP2, un factor relacionado con la oligoastenozoospermia, causa subfertilidad en ratones machos. J. Cell Mol. Medicina. 23, 2583 & # x20132594. doi: 10.1111 / jcmm.14149

Zhu, H., Cui, Y., Xie, J., Chen, L., Chen, X., Guo, X., et al. (2010). El análisis proteómico de las biopsias de testículo en hombres tratados con hipertermia escrotal transitoria revela los objetivos potenciales para el desarrollo de anticonceptivos. Proteómica 10, 3480 y # x20133493. doi: 10.1002 / pmic.201000281

Palabras clave: diferenciación espermátida, proteína de unión a ARN, infertilidad masculina, oligoasteno-teratozoospermia, TULP2

Cita: Zheng M, Chen X, Cui Y, Li W, Dai H, Yue Q, Zhang H, Zheng Y, Guo X y Zhu H (2021) TULP2, una nueva proteína de unión a ARN, es necesaria para la diferenciación de espermátidas de ratón y Fertilidad masculina. Parte delantera. Cell Dev. Biol. 9: 623738. doi: 10.3389 / fcell.2021.623738

Recibido: 30 de octubre de 2020 Aceptado: 27 de enero de 2021
Publicado: 18 de febrero de 2021.

Dominic C. Voon, Universidad de Kanazawa, Japón

Mahboobeh Amoushahi, Universidad de Aarhus, Dinamarca
Kaio Cesar Chaboli Alevi, Universidad Estatal S & # x00E3o Paulo, Brasil

Copyright & # x00A9 2021 Zheng, Chen, Cui, Li, Dai, Yue, Zhang, Zheng, Guo y Zhu. Este es un artículo de acceso abierto distribuido bajo los términos de la Licencia de atribución Creative Commons (CC BY). Se permite el uso, distribución o reproducción en otros foros, siempre que se acredite al autor (es) original (es) y al propietario (es) de los derechos de autor y se cite la publicación original en esta revista, de acuerdo con la práctica académica aceptada. No se permite ningún uso, distribución o reproducción que no cumpla con estos términos.


Ver el vídeo: ΌΛΗ Η ΑΛΉΘΕΙΑ για την Σκόνη Πρωτεΐνης (Julio 2022).


Comentarios:

  1. Berford

    ¿Y otra variante es?

  2. Ty

    la elección para ti difícil

  3. Shaktigore

    Yo debería

  4. Febei

    En mi opinión, admites el error. Puedo defender mi posición.



Escribe un mensaje